Entry information : TvCIIBB03 (MnP10-short)
Entry ID 9604
Creation 2011-10-05 (Christophe Dunand)
Last sequence changes 2012-03-28 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-01-07 (Nizar Fawal)
Peroxidase information: TvCIIBB03 (MnP10-short)
Name (synonym) TvCIIBB03 (MnP10-short)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvCIIBB03
start..stop
S start..stop
TvCIIBB15_KN9522 711 0 1..361 1..361
PcriCIIBB05 512 0 1..361 1..355
PoVP04_PC15 507 0 1..361 1..354
BaCIIBB03 502 5e-180 1..361 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2713545..2713605 61 N° 2 2713665..2714007 343 N° 3 2714080..2714277 198 N° 4 2714339..2714693 355
N° 5 2714755..2714883 129  
join(2713545..2713605,2713665..2714007,2714080..2714277,2714339..2714693,2714755 ..2714883)


exon

Literature and cross-references TvCIIBB03 (MnP10-short)
DNA ref. JGI genome:   scaffold_3 (2713545..2714883)
Protein sequence: TvCIIBB03 (MnP10-short)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (340)
PWM (Da):   %s   37860.99 (35760.8)  
PI (pH):   %s   4.84 (4.75) Peptide Signal:   %s   cut: 22 range:22-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFKALISILSVVGAIQVATAATTHRIACPDGVHTATNAVCCPLYAVVEDLQESLFDGGECGEETHESLRLTFHDAIGFSPALARQHKFGGGGADGSIITFDTIETAFHANGGIDDIVDVQKPFVTKHNMTAGDFIQLAGAVGFSNCAGAPRLEYLHGRPPAVAPSPDLLVPEPFDSVTKILARFADAGFSPDEVVALLASHSVAAADHVDPTIPGTPFDSTASSFDSQVFVEVLLRGTLFPGTAGNQGESKSALEGEIRLQSDNDVARDPRTACEWQSFVGNQAKLQSAFRAAMSKLAILGHNRRDLVDCSEVIPIPPANTRAHIPAGLSRRDIEQSCRQVPFPVLPVDAGPATSVAPV*

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCAAGGCCCTCATCTCCATCCTCTCCGTGGTCGGAGCCATCCAGGTCGCCACCGGTACGTGCATCCGCCGCTAGTACTGCACAACACCCCATCTAACCGCCTGTTCTCCACAG

CGGCCACGACCCACAGGATCGCCTGCCCCGACGGTGTGCACACCGCGACCAACGCAGTGTGCTGCCCGCTCTATGCAGTCGTCGAGGACCTGCAGGAGTCGCTCTTCGACGGCGGCGAGT
GCGGCGAGGAGACGCACGAGTCCCTGCGGCTCACGTTCCACGACGCGATCGGCTTCTCGCCCGCGCTCGCGCGCCAGCACAAGTTCGGCGGCGGCGGCGCGGACGGCTCGATCATCACGT
TCGACACCATCGAGACCGCGTTCCACGCGAACGGCGGCATCGACGACATTGTGGACGTGCAGAAGCCGTTCGTCACGAAGCACAACATGACTGCCGGGGACTT
GTAAGTGCCCATTCCTC
GCCCTTCCTTCCCTAGAGTCGGTGCAGTGCTGAATTGCGCCCTGTCTGTGTGTAGCATTCAGCTCGCTGGGGCTGTCGGCTTCTCGAACTGCGCCGGTGCACCCCGCCTGGAGTACCTCC
ACGGTCGCCCGCCTGCGGTTGCGCCCTCGCCCGACCTGCTCGTCCCCGAGCCCTTCGACTCTGTCACGAAGATCCTCGCGCGCTTCGCCGACGCCGGCTTCTCGCCCGATGAGGTCGTCG
CCCTCCTCGCCTC
GTACGTCCACCCCCTTCCGATAGCGATAGAACCCCGCTGACCCAGCTTGCCCCCTCGCCAGCCACTCGGTCGCTGCCGCCGACCACGTCGACCCGACGATCCCGGGC
ACTCCGTTCGACTCGACCGCGTCCTCGTTCGACTCGCAGGTGTTCGTCGAGGTGCTGCTCCGCGGCACGCTCTTCCCCGGCACGGCGGGCAACCAGGGCGAGTCGAAGAGCGCGCTGGAG
GGCGAGATCCGGCTGCAGTCTGACAACGACGTCGCGCGCGACCCGCGCACGGCGTGCGAGTGGCAGTCGTTCGTCGGCAACCAGGCGAAGCTGCAGTCCGCGTTCCGCGCCGCGATGTCG
AAGCTCGCCATCCTTGGCCACAACCGCCGCGACCTCGTCGACTGCTCTGAGGTCATCCCCATCCCGCCG
GTGAGTTCCCTCCACCCCTCCATGTGCAATAGAATCGCGATGCTCATAGAT
TTTCTTCCAGCCCGCGAACACCCGTGCGCACATCCCCGCGGGCCTGAGCCGCCGTGACATCGAGCAGTCGTGCCGCCAGGTGCCCTTCCCCGTGCTCCCCGTCGACGCCGGCCCCGCCAC
CTCTGTCGCCCCTGTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTCAAGGCCCTCATCTCCATCCTCTCCGTGGTCGGAGCCATCCAGGTCGCCACCGCGGCCACGACCCACAGGATCGCCTGCCCCGACGGTGTGCACACCGCGACCAACGCAGTG
TGCTGCCCGCTCTATGCAGTCGTCGAGGACCTGCAGGAGTCGCTCTTCGACGGCGGCGAGTGCGGCGAGGAGACGCACGAGTCCCTGCGGCTCACGTTCCACGACGCGATCGGCTTCTCG
CCCGCGCTCGCGCGCCAGCACAAGTTCGGCGGCGGCGGCGCGGACGGCTCGATCATCACGTTCGACACCATCGAGACCGCGTTCCACGCGAACGGCGGCATCGACGACATTGTGGACGTG
CAGAAGCCGTTCGTCACGAAGCACAACATGACTGCCGGGGACTT
CATTCAGCTCGCTGGGGCTGTCGGCTTCTCGAACTGCGCCGGTGCACCCCGCCTGGAGTACCTCCACGGTCGCCCG
CCTGCGGTTGCGCCCTCGCCCGACCTGCTCGTCCCCGAGCCCTTCGACTCTGTCACGAAGATCCTCGCGCGCTTCGCCGACGCCGGCTTCTCGCCCGATGAGGTCGTCGCCCTCCTCGCC
TC
CCACTCGGTCGCTGCCGCCGACCACGTCGACCCGACGATCCCGGGCACTCCGTTCGACTCGACCGCGTCCTCGTTCGACTCGCAGGTGTTCGTCGAGGTGCTGCTCCGCGGCACGCTC
TTCCCCGGCACGGCGGGCAACCAGGGCGAGTCGAAGAGCGCGCTGGAGGGCGAGATCCGGCTGCAGTCTGACAACGACGTCGCGCGCGACCCGCGCACGGCGTGCGAGTGGCAGTCGTTC
GTCGGCAACCAGGCGAAGCTGCAGTCCGCGTTCCGCGCCGCGATGTCGAAGCTCGCCATCCTTGGCCACAACCGCCGCGACCTCGTCGACTGCTCTGAGGTCATCCCCATCCCGCCG
CCC
GCGAACACCCGTGCGCACATCCCCGCGGGCCTGAGCCGCCGTGACATCGAGCAGTCGTGCCGCCAGGTGCCCTTCCCCGTGCTCCCCGTCGACGCCGGCCCCGCCACCTCTGTCGCCCCT
GTGTAA

Retrieve as FASTA