Entry information : TvCIIBB07 (MnP8-short)
Entry ID 9605
Creation 2011-10-05 (Christophe Dunand)
Last sequence changes 2011-10-05 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2013-10-18 (Nizar Fawal)
Peroxidase information: TvCIIBB07 (MnP8-short)
Name (synonym) TvCIIBB07 (MnP8-short)
Class Other class II peroxidase type B     [Orthogroup: CIIBB001]*
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Trametes
Organism Trametes versicolor (Coriolus versicolor )    [TaxId: 5325 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TvCIIBB07
start..stop
S start..stop
TvCIIBB09 483 1e-172 1..352 3..355
TvCIIBB06 483 2e-172 3..352 5..355
TvCIIBB06_Gangwondo 480 2e-171 3..352 5..355
TvCIIBB10 473 4e-168 8..351 50..394
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2306504..2306558 55 N° 2 2306619..2306958 340 N° 3 2307016..2307213 198 N° 4 2307274..2307515 242
N° 5 2307576..2307814 239  
join(2306504..2306558,2306619..2306958,2307016..2307213,2307274..2307515,2307576 ..2307814)


exon

Literature and cross-references TvCIIBB07 (MnP8-short)
DNA ref. JGI genome:   scaffold_10 (2306504..2307814)
Protein sequence: TvCIIBB07 (MnP8-short)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   357 (338)
PWM (Da):   %s   37486.65 (35451.5)  
PI (pH):   %s   3.99 (3.91) Peptide Signal:   %s   cut: 20 range:20-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTLISLFLSLLAVLRVAHGALISRATCATGQVVVNEACCVLFPILEDIQENLFDGGQCGEAVRESLRLAFHDAIGISPLLEEMGEFGGGGADGSISIFAETETEYSANLGLDEIINEQASFIANHDLGTADFIQFAAAVGLSNCPGAPALKFFIGRTDATQAAPDHTVPLPFDTVNSILARFADAGFSAAQVVALLAAHTIATADHVDPTIPGTPLDTTPELFDTQFYVETLLRGTLFPGTSGNQGEVMSPLSGELRLQSDSLLARDARTACEWQSFNDQIKLQTEFKAAFEKLAVLGQDPSALVDCSDAMPTPPASGSNAHFPAGITHEDVQQACALSAFPALSTEIPPLDPFKR

Retrieve as FASTA  
Remarks Complete sequence from genomic (4 introns). The last short exon is missing, but it could not be manualy predicted.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGCTCATTAGTCTTTTCTTGTCTCTCCTCGCTGTCCTCCGGGTCGCTCATGGTACGAGGTCCTTTACCTGTAGCAGTGCACATCACTAATGCATGTCGTATATCTGTTCAGGTGCC
TTGATTAGCCGTGCGACGTGTGCTACCGGCCAGGTCGTTGTCAACGAGGCCTGCTGCGTGCTCTTCCCTATTCTCGAGGATATCCAGGAGAACCTGTTCGACGGTGGCCAGTGCGGTGAG
GCGGTGCGCGAGTCCCTCCGCCTTGCCTTTCACGACGCCATTGGAATCTCGCCTCTCCTCGAGGAGATGGGCGAGTTCGGCGGCGGAGGTGCGGACGGTTCGATCTCCATCTTTGCGGAA
ACCGAGACCGAGTACTCCGCAAACCTCGGTCTCGACGAAATCATTAACGAGCAGGCGTCGTTCATCGCTAATCATGACCTCGGTACCGCTGACTT
GTACGTAGATATGCTTCCGTTATTC
TAATCTGACACCCTTCTGACACGCGACTGTAGCATACAGTTTGCTGCCGCGGTCGGGCTCAGCAATTGCCCAGGCGCACCCGCCCTGAAATTCTTCATCGGACGCACGGACGCTACACAG
GCCGCGCCCGACCATACGGTGCCCCTCCCGTTCGACACGGTTAACTCGATCCTTGCGCGCTTTGCTGACGCCGGGTTCTCCGCCGCCCAAGTCGTCGCTCTTCTCGCCGC
GTACGTTTCC
TCCATCATTTTCTTCCTCGTTTAGACAGTACGCAGACCTACGGCGAGCAGGCACACTATTGCTACTGCCGACCACGTAGACCCGACGATCCCCGGAACGCCGTTGGACACCACTCCAGAG
CTATTCGACACACAGTTCTACGTCGAGACTTTGCTTCGTGGGACCCTCTTTCCTGGCACCAGCGGCAATCAGGGCGAGGTGATGTCGCCGTTGAGCGGGGAGCTTCGCCTACAGTCCGAC
AGCCTGCTCGCGCGCGACGCGCGCACCGCGTGCGAGTGGCAGTCCTTCGTTA
GTACGTAGCCTAAGCCTTTTCTCTTCCCCTCTTCTGCGATTGTTTAACGTCACGCTACAGATGACCAA
ATCAAGCTTCAGACTGAATTCAAAGCCGCGTTCGAGAAGCTGGCAGTTTTGGGCCAGGACCCCTCCGCTCTCGTCGACTGCTCCGACGCTATGCCCACCCCACCCGCGTCCGGGAGCAAC
GCGCACTTCCCCGCTGGGATCACGCACGAGGACGTCCAGCAGGCCTGTGCGCTTTCGGCATTCCCCGCTCTCTCGACTGAAATACCGCCCCTGGATCCGTTTAAGCGTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGCTCATTAGTCTTTTCTTGTCTCTCCTCGCTGTCCTCCGGGTCGCTCATGGTGCCTTGATTAGCCGTGCGACGTGTGCTACCGGCCAGGTCGTTGTCAACGAGGCCTGCTGCGTG
CTCTTCCCTATTCTCGAGGATATCCAGGAGAACCTGTTCGACGGTGGCCAGTGCGGTGAGGCGGTGCGCGAGTCCCTCCGCCTTGCCTTTCACGACGCCATTGGAATCTCGCCTCTCCTC
GAGGAGATGGGCGAGTTCGGCGGCGGAGGTGCGGACGGTTCGATCTCCATCTTTGCGGAAACCGAGACCGAGTACTCCGCAAACCTCGGTCTCGACGAAATCATTAACGAGCAGGCGTCG
TTCATCGCTAATCATGACCTCGGTACCGCTGACTT
CATACAGTTTGCTGCCGCGGTCGGGCTCAGCAATTGCCCAGGCGCACCCGCCCTGAAATTCTTCATCGGACGCACGGACGCTACA
CAGGCCGCGCCCGACCATACGGTGCCCCTCCCGTTCGACACGGTTAACTCGATCCTTGCGCGCTTTGCTGACGCCGGGTTCTCCGCCGCCCAAGTCGTCGCTCTTCTCGCCGC
GCACACT
ATTGCTACTGCCGACCACGTAGACCCGACGATCCCCGGAACGCCGTTGGACACCACTCCAGAGCTATTCGACACACAGTTCTACGTCGAGACTTTGCTTCGTGGGACCCTCTTTCCTGGC
ACCAGCGGCAATCAGGGCGAGGTGATGTCGCCGTTGAGCGGGGAGCTTCGCCTACAGTCCGACAGCCTGCTCGCGCGCGACGCGCGCACCGCGTGCGAGTGGCAGTCCTTCGTTA
ATGAC
CAAATCAAGCTTCAGACTGAATTCAAAGCCGCGTTCGAGAAGCTGGCAGTTTTGGGCCAGGACCCCTCCGCTCTCGTCGACTGCTCCGACGCTATGCCCACCCCACCCGCGTCCGGGAGC
AACGCGCACTTCCCCGCTGGGATCACGCACGAGGACGTCCAGCAGGCCTGTGCGCTTTCGGCATTCCCCGCTCTCTCGACTGAAATACCGCCCCTGGATCCGTTTAAGCGTTGA

Retrieve as FASTA