Entry information : LmaCIIAA01
Entry ID 9625
Creation 2011-10-17 (Christophe Dunand)
Last sequence changes 2011-10-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-04-23 (Catherine Mathe (Scipio))
Peroxidase information: LmaCIIAA01
Name LmaCIIAA01
Class Asco Class II type A    [Orthogroup: CIIAA001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Leptosphaeriaceae Leptosphaeria
Organism Leptosphaeria maculans    [TaxId: 5022 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LmaCIIAA01
start..stop
S start..stop
COsaCIIAA05 691 0 1..399 1..399
AalteCIIAA01 691 0 1..398 1..398
PtritCIIAA02 690 0 1..400 1..400
PterCIIAA02 688 0 1..398 1..398
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 165660..166649 990 N° 2 166700..166912 213  
join(165660..166649,166700..166912)


exon

Literature and cross-references LmaCIIAA01
Literature Rouxel,T. et al. Effector diversification within compartments of the Leptosphaeria. maculans genome affected by Repeat-Induced Point mutations. Nat Commun 2, 202 (2011)
Protein ref. UniProtKB:   E4ZH58
DNA ref. JGI genome:   lm_SuperContig_8_v2 (165660..166912)
Protein sequence: LmaCIIAA01
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   400 (380)
PWM (Da):   %s   43617.95 (41359.7)  
PI (pH):   %s   7.25 (7.20) Peptide Signal:   %s   cut: 21 range:21-400
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKISTHLLYAFMVLLPLTDAHPGMTSQITTMRRLAAKQSRQASKELIGDLKTLPDSKLTPIAKDIKAIILDQKSAESNTIDSSIPAGNIGSAACKADACCHWKWLAYEMTAKFNGTSGRCTKFARQAVRLGFHDAGVWTKTSGYGGADGSILLSNEMSRTDNDGLQAIADQTKKWYNKYNQHGMSMADIIQFGANVATVVCPLGPRVRSFVGRKDNSNAGPTGLLPGEKDSADTLLKLFAAKTIDAHDLVALVGAHTTSQQHFVDTTRDGDPQDTTPGVWDIAFYPQTTANPPVRVLKFQSDINLSKDSRTKGEWAEFSDRNLGQSHWNEDYAKAYTRLSLLGVNNINELKECTKVMPAARTTFVSEDQVLLDRWLNGEFDQLNNLVDDAIQLTGVVSGT*

Retrieve as FASTA  
Remarks Complete sequence from genomic (1 intron). No EST. Isolate="JN3 / isolate v23.1.3 / race Av1-4-5-6-7-8".
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATCTCCACTCATCTCTTATATGCCTTCATGGTACTCCTCCCCCTCACAGACGCCCACCCAGGAATGACCTCCCAAATAACCACAATGCGCCGGCTCGCCGCCAAACAATCCCGA
CAAGCCTCCAAAGAACTCATCGGCGATCTCAAAACCCTGCCCGACTCCAAACTAACCCCCATCGCCAAAGACATCAAAGCCATTATCCTTGACCAAAAGTCTGCAGAATCAAACACAATC
GACTCTTCCATCCCTGCTGGCAACATTGGCAGCGCCGCCTGCAAAGCAGACGCCTGTTGCCATTGGAAATGGCTTGCATATGAGATGACGGCCAAGTTCAACGGCACCTCGGGACGGTGC
ACCAAGTTTGCCAGACAGGCTGTTCGACTTGGGTTCCATGACGCGGGGGTGTGGACTAAGACTAGTGGATATGGAGGTGCGGATGGGAGTATCCTGCTCAGCAACGAGATGAGCCGGACA
GACAATGATGGACTGCAGGCTATTGCTGATCAGACCAAGAAGTGGTATAACAAGTACAATCAGCATGGCATGAGCATGGCAGACATTATCCAGTTTGGTGCCAACGTCGCCACCGTGGTC
TGCCCACTCGGTCCTCGGGTTCGCAGTTTTGTGGGAAGAAAGGACAACAGCAACGCAGGGCCGACGGGACTGTTGCCGGGGGAAAAGGACTCGGCGGACACGCTGTTGAAGCTATTCGCA
GCCAAGACAATCGATGCGCATGATCTTGTGGCGTTGGTGGGTGCGCATACGACATCGCAGCAGCATTTTGTCGATACAACACGTGATGGTGATCCACAGGATACTACGCCTGGTGTTTGG
GATATTGCATTCTACCCGCAGACGACGGCAAATCCGCCTGTGAGGGTGCTGAAGTTTCAGAGTGATATCAATCTGAGCAAAGATTCCAGGACGAAAGGCGAATGGGCCGAGTTCAGCGAC
CGTAATCTCGGACAAAGTCACTGGAACGAG
GTTTGTTGATGTTTGTTTGATGATGGTAGGATACATACTGATTTTAGCAGGACTACGCAAAAGCTTACACTCGCCTCTCACTCCTTGGTG
TAAATAATATCAATGAGTTGAAAGAGTGCACAAAGGTGATGCCCGCAGCACGCACGACATTCGTCAGTGAGGACCAAGTGCTACTTGATAGGTGGCTGAATGGCGAATTCGATCAACTGA
ATAACCTAGTTGACGATGCTATCCAGCTCACGGGCGTTGTCTCTGGAACATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGATCTCCACTCATCTCTTATATGCCTTCATGGTACTCCTCCCCCTCACAGACGCCCACCCAGGAATGACCTCCCAAATAACCACAATGCGCCGGCTCGCCGCCAAACAATCCCGA
CAAGCCTCCAAAGAACTCATCGGCGATCTCAAAACCCTGCCCGACTCCAAACTAACCCCCATCGCCAAAGACATCAAAGCCATTATCCTTGACCAAAAGTCTGCAGAATCAAACACAATC
GACTCTTCCATCCCTGCTGGCAACATTGGCAGCGCCGCCTGCAAAGCAGACGCCTGTTGCCATTGGAAATGGCTTGCATATGAGATGACGGCCAAGTTCAACGGCACCTCGGGACGGTGC
ACCAAGTTTGCCAGACAGGCTGTTCGACTTGGGTTCCATGACGCGGGGGTGTGGACTAAGACTAGTGGATATGGAGGTGCGGATGGGAGTATCCTGCTCAGCAACGAGATGAGCCGGACA
GACAATGATGGACTGCAGGCTATTGCTGATCAGACCAAGAAGTGGTATAACAAGTACAATCAGCATGGCATGAGCATGGCAGACATTATCCAGTTTGGTGCCAACGTCGCCACCGTGGTC
TGCCCACTCGGTCCTCGGGTTCGCAGTTTTGTGGGAAGAAAGGACAACAGCAACGCAGGGCCGACGGGACTGTTGCCGGGGGAAAAGGACTCGGCGGACACGCTGTTGAAGCTATTCGCA
GCCAAGACAATCGATGCGCATGATCTTGTGGCGTTGGTGGGTGCGCATACGACATCGCAGCAGCATTTTGTCGATACAACACGTGATGGTGATCCACAGGATACTACGCCTGGTGTTTGG
GATATTGCATTCTACCCGCAGACGACGGCAAATCCGCCTGTGAGGGTGCTGAAGTTTCAGAGTGATATCAATCTGAGCAAAGATTCCAGGACGAAAGGCGAATGGGCCGAGTTCAGCGAC
CGTAATCTCGGACAAAGTCACTGGAACGAG
GACTACGCAAAAGCTTACACTCGCCTCTCACTCCTTGGTGTAAATAATATCAATGAGTTGAAAGAGTGCACAAAGGTGATGCCCGCAGCA
CGCACGACATTCGTCAGTGAGGACCAAGTGCTACTTGATAGGTGGCTGAATGGCGAATTCGATCAACTGAATAACCTAGTTGACGATGCTATCCAGCTCACGGGCGTTGTCTCTGGAACA
TAA

Retrieve as FASTA