Entry information : PbreCIIBB10 (MnP10-short)
Entry ID 9629
Creation 2011-10-24 (Christophe Dunand)
Last sequence changes 2011-10-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PbreCIIBB10 (MnP10-short)
Name (synonym) PbreCIIBB10 (MnP10-short)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phlebia
Organism Phlebia brevispora    [TaxId: 194682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PbreCIIBB10
start..stop
S start..stop
PbreCIIBB09 581 0 1..367 1..365
PrCIIBB03 579 0 1..367 1..362
TvCIIBB02 549 0 1..367 1..365
TvCIIBB02_IFO30340 549 0 1..367 1..365
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 839089..839140 52 N° 2 839194..839401 208 N° 3 839463..839597 135 N° 4 839649..839716 68
N° 5 839766..839819 54 N° 6 839876..839966 91 N° 7 840023..840148 126 N° 8 840202..840271 70
N° 9 840327..840372 46 N° 10 840441..840613 173 N° 11 840674..840741 68 N° 12 840784..840796 13
join(839089..839140,839194..839401,839463..839597,839649..839716,839766..839819, 839876..839966,840023..840148,840202..840271,840327..840372,840441..840613,84067 4..840741,840784..840796)


exon

Literature and cross-references PbreCIIBB10 (MnP10-short)
DNA ref. JGI genome:   scaffold_6 (839089..840796)
Protein sequence: PbreCIIBB10 (MnP10-short)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   367 (349)
PWM (Da):   %s   38410.98 (36615.0)  
PI (pH):   %s   4.14 (4.11) Peptide Signal:   %s   cut: 19 range:19-367
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALKQLSTIVSLALAANAAITRRVACPDGVNTATNAACCALFAVRDTLVQDFFDGGECGEEVHESLRLTFHDAIGISPAIAVIAGFGGGGADGSIAIFEDIETNFHANLGIDEIIDEQRPFVQASNMTTADFIQFAGAVGVSNCPGAPALDVFGRQDAILPAPDKTVPEPFDTVDSILSRFQDAFSDVGGFTPAEVVALLVSHTIAAADHVDPSIPGTPFDSTPGIFDSQFFIETQLRGVVFPGTGGNQGEVESPLMGELRLQSDSLARDSRTNCEWQSFVNNQPKIQSAFKAAFRRMTVLGHNEADLIDCSEVIKAPPLLKSNAHLPAGKTMNDVEQCATAAFPSLSADLGPATSCVSPLPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTCAAACAGCTCTCCACTATTGTTTCCCTCGCACTCGCCGCCAATGGTAAGCACAAACTTCCTGACTCCAAACGCTGGGGATAGTGATCGTACCTACAGCCGCGATCACAAGGC
GTGTCGCATGCCCTGACGGTGTGAACACCGCGACGAACGCCGCGTGCTGCGCCTTGTTCGCTGTCCGCGACACCCTCGTCCAGGACTTCTTCGACGGCGGAGAGTGCGGAGAAGAGGTGC
ACGAGTCCCTCCGTCTGACCTTCCACGACGCCATCGGCATCTCGCCGGCCATTGCTGTCATAGCTGGCTTCGG
GTGTGCCTGCCTCCGTCCTGACTCCCTGCCGCTCAAAGCGCCTAATA
CGTCTGTCTTGCAGTGGCGGAGGCGCTGATGGCTCGATCGCCATCTTCGAGGACATCGAGACGAACTTCCACGCGAACCTGGGCATCGATGAGATCATTGACGAGCAACGGCCCTTCGTC
CAGGCCAGCAACATGACCACCGCTGACTT
GTAAGATTTTCCAGTCTTTTGTCTGGATTTAGAGAACCAACCTACTTGTAGCATCCAGTTCGCTGGCGCAGTCGGTGTCAGCAACTGCCCT
GGTGCTCCCGCCCTCGATGTCTTCATTG
GTATGTAATCCGCGTTCAGCTTGCGCGAGGATTACTGACGTTCCGGTAGGTCGTCAGGATGCCATACTGCCCGCTCCCGACAAGACGGTCCC
CGAGCCTTTCG
GTAAGCATTTCACAATTGAATATTAAACAGCCACGCATTCTCACCGGGGATTACAGACACCGTCGACAGCATCCTGTCCCGCTTCCAGGATGCCTTTTCCGATGTGGGG
GGCTTCACCCCCGCCGAAGTCGTTGCTCTCCTCGTCTC
GTAAGTGTTTCCCTCATTTTCTGGATCCGTGAGGTTTCAGATGTTGTTCACTGCAGGCATACCATCGCCGCCGCTGACCACG
TCGACCCTTCTATCCCTGGCACACCTTTCGACTCTACTCCTGGGATCTTCGACTCTCAGTTCTTCATCGAAACCCAACTCCGTGGTGTTGTCTTCCCAGG
GTAGGTGCCCTCACCCTTTT
TCAGAACAGGAGCCACCTGATGGTTCGACCCAGCACCGGTGGCAACCAGGGTGAGGTCGAGTCGCCGCTGATGGGCGAGCTCCGCCTGCAGTCAGACTCCGAGGTGCGACTGCACACTCT
CCTTGACCTCCTGTAGCAATTCTGAATGGGCATTTTAGCTTGCTCGTGACTCCAGGACCAACTGCGAGTGGCAATCCTTCGTCAGTAAGCACACCCTAACACCACCTGCCACATATACCT
TCTGACATGCATGCTCGCCTAAATTCAAATAGACAACCAACCGAAGATTCAGAGCGCGTTCAAGGCCGCATTCAGGCGTATGACCGTCCTCGGCCACAACGAGGCGGACCTCATCGACTG
CTCTGAGGTCATCAAGGCGCCGCCGCTGCTCAAGAGTAACGCGCACCTCCCCGCCGGGAAGACCATGAACGATGTAGAGCAAGCT
GTAAGGCCCTTCCTAGTTTCGTGACTGCCTTCGTA
GTTTCTAATTGTTCGCCTCGCATAGTGCGCCACTGCTGCGTTCCCGTCCCTCTCTGCCGACCTGGGACCCGCTACCTCCTGTGTAAGTCCACTGTCACAGCTATCCATGCGTGCTGACTC
ATCGTTAGCGATCAGTCCGCCGTCTTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCTCAAACAGCTCTCCACTATTGTTTCCCTCGCACTCGCCGCCAATGCCGCGATCACAAGGCGTGTCGCATGCCCTGACGGTGTGAACACCGCGACGAACGCCGCGTGCTGCGCC
TTGTTCGCTGTCCGCGACACCCTCGTCCAGGACTTCTTCGACGGCGGAGAGTGCGGAGAAGAGGTGCACGAGTCCCTCCGTCTGACCTTCCACGACGCCATCGGCATCTCGCCGGCCATT
GCTGTCATAGCTGGCTTCGG
TGGCGGAGGCGCTGATGGCTCGATCGCCATCTTCGAGGACATCGAGACGAACTTCCACGCGAACCTGGGCATCGATGAGATCATTGACGAGCAACGGCCC
TTCGTCCAGGCCAGCAACATGACCACCGCTGACTT
CATCCAGTTCGCTGGCGCAGTCGGTGTCAGCAACTGCCCTGGTGCTCCCGCCCTCGATGTCTTCATTGGTCGTCAGGATGCCATA
CTGCCCGCTCCCGACAAGACGGTCCCCGAGCCTTTCG
ACACCGTCGACAGCATCCTGTCCCGCTTCCAGGATGCCTTTTCCGATGTGGGGGGCTTCACCCCCGCCGAAGTCGTTGCTCTC
CTCGTCTC
GCATACCATCGCCGCCGCTGACCACGTCGACCCTTCTATCCCTGGCACACCTTTCGACTCTACTCCTGGGATCTTCGACTCTCAGTTCTTCATCGAAACCCAACTCCGTGGT
GTTGTCTTCCCAGG
CACCGGTGGCAACCAGGGTGAGGTCGAGTCGCCGCTGATGGGCGAGCTCCGCCTGCAGTCAGACTCCGAGCTTGCTCGTGACTCCAGGACCAACTGCGAGTGGCAA
TCCTTCGTCA
ACAACCAACCGAAGATTCAGAGCGCGTTCAAGGCCGCATTCAGGCGTATGACCGTCCTCGGCCACAACGAGGCGGACCTCATCGACTGCTCTGAGGTCATCAAGGCGCCG
CCGCTGCTCAAGAGTAACGCGCACCTCCCCGCCGGGAAGACCATGAACGATGTAGAGCAAGCT
TGCGCCACTGCTGCGTTCCCGTCCCTCTCTGCCGACCTGGGACCCGCTACCTCCTGT
GTAAGTCCACT
TCCGCCGTCTTGA

Retrieve as FASTA