Entry information : PbreCIIBB09 (MnP9-short)
Entry ID 9630
Creation 2011-10-24 (Christophe Dunand)
Last sequence changes 2011-10-24 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-28 (Catherine Mathe (Scipio))
Peroxidase information: PbreCIIBB09 (MnP9-short)
Name (synonym) PbreCIIBB09 (MnP9-short)
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Corticiaceae Phlebia
Organism Phlebia brevispora    [TaxId: 194682 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PbreCIIBB09
start..stop
S start..stop
PrCIIBB03 615 0 1..365 1..362
PbreCIIBB10 581 0 1..365 1..367
TvCIIBB02_IFO30340 578 0 1..365 1..365
TvCIIBB02 578 0 1..365 1..365
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 786474..786534 61 N° 2 786213..786420 208 N° 3 786027..786161 135 N° 4 785903..785970 68
N° 5 785838..785849 12 N° 6 785741..785782 42 N° 7 785604..785682 79 N° 8 785421..785546 126
N° 9 785300..785369 70 N° 10 785192..785237 46 N° 11 784968..785140 173 N° 12 784849..784913 65
N° 13 784779..784791 13  
complement(join(784779..784791,784849..784913,784968..785140,785192..785237,7853 00..785369,785421..785546,785604..785682,785741..785782,785838..785849,785903..7 85970,786027..786161,786213..786420,786474..786534))


exon

Literature and cross-references PbreCIIBB09 (MnP9-short)
DNA ref. JGI genome:   scaffold_6 (786534..784779)
Protein sequence: PbreCIIBB09 (MnP9-short)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365 (344)
PWM (Da):   %s   38185.9 (35971.6)  
PI (pH):   %s   4.18 (4.10) Peptide Signal:   %s   cut: 22 range:22-365
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLLIAVTIALAFKVAQGALTHRVACPDGVNTATNAACCSLFALRDTLQDQFFDGGECGEEVHESLRLTFHDAIGISPAIAATGVFGGGGADGSIAIFEDIETNFHANLGVDEIIDEQKSFVQSSNLTTADFIQFAGAVGVSNCPGAPRLPVFGRNDATQPAPDKTVPEPFDTVDSILARFNDAGGFTSAEVVALLASHTIAAADHVDPSIPGTPFDSTPGVFDTQFFVETQLRGILFPGTGGNQGEVESPLAGEIRLQSDSLARDSRTACEWQSFVNNQAKIQSAFQAAFRKMTILGHSESSLIECSEVIEEPPTLNVIAHLPAGKTHNDVEQCATIPFPSLSADPGPVTSVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGCAGCTTCTCATTGCAGTCACCATTGCCTTGGCCTTCAAGGTTGCACAAGGTACTCGCAATCTGTACTGGAGCAGCCCCAAGGACACTAAACTATGTTTCTAGGTGCAC
TTACCCACCGAGTTGCTTGCCCCGATGGCGTCAACACCGCCACGAACGCCGCTTGCTGCTCGTTATTCGCGCTCCGTGACACTCTTCAGGACCAATTCTTTGACGGCGGCGAGTGTGGCG
AGGAAGTCCATGAGTCCCTTCGCCTGACCTTCCACGACGCTATTGGTATTTCACCCGCTATCGCCGCTACCGGTGTTTTCGG
GTAGGTCTTGTCCAGTAAAGCCCCGGAAGAATACTGAT
CGACAGTGTTCAGTGGTGGAGGCGCCGATGGCTCCATTGCCATCTTTGAGGATATCGAGACGAACTTCCATGCCAACCTGGGCGTTGACGAAATCATCGACGAGCAGAAGTCATTTGTTC
AGTCGAGCAACTTGACCACCGCTGATTT
GTAAGTGCACCCCTCCGTATTGGAGAGATTTCCTGTTGTGTTAAGATTTATTGCAGTATTCAATTCGCTGGTGCAGTCGGCGTCAGCAACTG
TCCTGGCGCACCTCGTCTGCCCGTCTTCATCG
GTACGTTTTCTATCACCTTTCTGAATGATTAGTGCTCACTCCTGTCTGCTCAGGTCGCAACGATGGTGCGCGTTAACTGGTCTACACG
AGGAGTCATTTCTGAATCAAGTTTTCCGACAGCTACGCAGCCTGCTCCCGACAAGACCGTGCCTGAACCATTTGGTAAGTGGCGATATTGCATCGCTACCACACCAGCGGGAAAGTCTAA
TAGTAGATATAGACACTGTTGATAGCATTCTGGCTCGCTTCAATGATGCTGGTGGCTTTACGTCCGCGGAAGTCGTTGCTCTGCTCGCTTCGTGAGTCTACTATTTCTGCATTATCAATG
ATCTACTCTCACATACCCTCGCACGTAGTCACACGATCGCTGCTGCAGACCATGTCGACCCCAGCATCCCAGGTACTCCATTCGATTCCACTCCCGGCGTCTTCGATACACAGTTCTTCG
TTGAAACCCAACTTCGCGGCATCCTCTTCCCTGG
GTGAGTTAACAGTTTTGTCACAGTTATGCATACACTCAGAGATTGCAATAGCACTGGTGGTAATCAAGGCGAGGTTGAGTCTCCGT
TGGCGGGAGAAATTCGTCTTCAATCCGATTCCGAG
GTATGTCCCTTGCGGAAGCCGCTGAAGAAAAGTAAAAGTGTTCTTATACCTCCTCTTTGCAGCTTGCTCGCGATTCCAGGACTGC
TTGCGAGTGGCAGTCATTCGTCA
GTGAGTCCAAACAGTCTTGTTCAGGCCATCAGAATACTGAACTCGCATTAGATAACCAGGCTAAGATCCAGAGCGCCTTCCAAGCAGCTTTCAGGAA
GATGACGATCCTTGGTCACTCTGAGAGCAGCTTGATTGAGTGCTCCGAAGTCATTGAGGAGCCGCCTACCCTTAACGTCATTGCTCACCTTCCCGCTGGCAAGACCCATAACGATGTTGA
GCAGGCT
GTACGTACAATATGCTTCACGTCACTTCATGAAACTCACTGCAGCTTCTCTAAGTGCGCGACAATTCCCTTCCCGTCCCTCAGTGCTGATCCCGGTCCTGTCACTTCTGTGGC
TCCAGT
GTAAGTGGTGCAGCCTACGTTTATGCTTTCTTGCGCTAACGCGTGTTGTGTGCTAAGTCCCCCTTCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTTCAAGCAGCTTCTCATTGCAGTCACCATTGCCTTGGCCTTCAAGGTTGCACAAGGTGCACTTACCCACCGAGTTGCTTGCCCCGATGGCGTCAACACCGCCACGAACGCCGCT
TGCTGCTCGTTATTCGCGCTCCGTGACACTCTTCAGGACCAATTCTTTGACGGCGGCGAGTGTGGCGAGGAAGTCCATGAGTCCCTTCGCCTGACCTTCCACGACGCTATTGGTATTTCA
CCCGCTATCGCCGCTACCGGTGTTTTCGG
TGGTGGAGGCGCCGATGGCTCCATTGCCATCTTTGAGGATATCGAGACGAACTTCCATGCCAACCTGGGCGTTGACGAAATCATCGACGAG
CAGAAGTCATTTGTTCAGTCGAGCAACTTGACCACCGCTGATTT
TATTCAATTCGCTGGTGCAGTCGGCGTCAGCAACTGTCCTGGCGCACCTCGTCTGCCCGTCTTCATCGGTCGCAAC
GATG
CTACGCAGCCTGCTCCCGACAAGACCGTGCCTGAACCATTTGACACTGTTGATAGCATTCTGGCTCGCTTCAATGATGCTGGTGGCTTTACGTCCGCGGAAGTCGTTGCTCTGCTC
GCTTC
TCACACGATCGCTGCTGCAGACCATGTCGACCCCAGCATCCCAGGTACTCCATTCGATTCCACTCCCGGCGTCTTCGATACACAGTTCTTCGTTGAAACCCAACTTCGCGGCATC
CTCTTCCCTGG
CACTGGTGGTAATCAAGGCGAGGTTGAGTCTCCGTTGGCGGGAGAAATTCGTCTTCAATCCGATTCCGAGCTTGCTCGCGATTCCAGGACTGCTTGCGAGTGGCAGTCA
TTCGTCA
ATAACCAGGCTAAGATCCAGAGCGCCTTCCAAGCAGCTTTCAGGAAGATGACGATCCTTGGTCACTCTGAGAGCAGCTTGATTGAGTGCTCCGAAGTCATTGAGGAGCCGCCT
ACCCTTAACGTCATTGCTCACCTTCCCGCTGGCAAGACCCATAACGATGTTGAGCAGGCT
TGCGCGACAATTCCCTTCCCGTCCCTCAGTGCTGATCCCGGTCCTGTCACTTCTGTGGCT
CCAGT
TCCCCCTTCTTAA

Retrieve as FASTA