Entry information : BdiPrx67
Entry ID 9636
Creation 2011-11-02 (Christophe Dunand)
Last sequence changes 2014-01-08 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-01-29 (Qiang Li)
Peroxidase information: BdiPrx67
Name BdiPrx67
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Brachypodium
Organism Brachypodium distachyon    [TaxId: 15368 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BdiPrx67
start..stop
S start..stop
SiPrx03 586 0 9..354 7..361
ZmPrx143 561 0 22..354 24..361
SbPrx63 514 0 22..332 22..341
OsPrx16 490 2e-175 22..335 18..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10579583..10579807 225 N° 2 10580834..10581265 432 N° 3 10581368..10582072 705  
join(10579583..10579807,10580834..10581265,10581368..10582072)


exon

Literature and cross-references BdiPrx67
DNA ref. Phytozome 12:   Bd2 (10579283..10582072)
Protein sequence: BdiPrx67
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (336)
PWM (Da):   %s   37571.11 (35714.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.97 (7.97) Peptide Signal:   %s   cut: 20 range:20-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSLAMNSLLATLAVAVLALFPIAAVGAGLKVGFYSKTCPSAETLVQQAVAASFKNNGGVAAGLIRLHFHDCFVKGCDGSVLIDSTANNTAEKDAIPNNPSLRGFEVIDAAKKAIEAKCPKIVSCADILAFAARDSIALAGNVTYKVPAGRRDGRISSDQNALNNLPSPLSTASELVGNFTLKNLTAEDMVVLSGAHTIGVSRCSSFTNRLYGFSNTSQVDPTMSSAYAFLLKNICPANSSQFFPNTTMDMDIITPAVLDNKYYVSLINNLGLFTSDQALLTNSTLKASVDEFVKNENRWKSKFVKSMVKMGNIEVLTGTQGEIRLNCRVINKGSTGLEFNSGINSGEFTEIATS*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Containing IntR (3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTCCCTCGCCATGAACTCCCTGCTCGCCACCTTGGCAGTTGCCGTCCTTGCCCTCTTCCCGATTGCTGCTGTCGGAGCTGGCCTGAAGGTCGGGTTCTACAGCAAGACCTGCCCA
TCCGCGGAGACCCTGGTGCAGCAGGCAGTGGCTGCTTCCTTCAAGAATAACGGTGGTGTCGCTGCTGGCCTCATCCGATTGCATTTCCACGACTGCTTTGTGAAA
GTATGTACACTGCAT
TTTTTTTCCTTTCTCTTATACCTGCACTGTTGACATAAAGGAAAGCCTGAGCTGTAAGTCCATCGTAGCAATCAACTTACACCTATAGGATTCCTTATTTGCACCCCTTAAGCAGAATGA
TAAACTGAGCGATAATTAAAGGAAGGTATTGTTTCTGCTGAAGATATGGCAAATACGGTATCTAAATTCTAAACATCTTTCTCGTAGCAGGAAATATAATACCATCCTTAATCAACATAA
GTAAATACTCCCTCCGATCCATAATAAGTATCGGGGGTTTAGTACAACGTCCCCGGCACTTATTATGGATCGGAGGGAGTAGCAGACAGTGATCAATATAAGTATTCCTCTCAGTTAGCT
GCAAGTGCAAGCTGAATACCATGTACTCCCTCCGTTCCATAATTCTTGTCTCAAATTTGCCCAAATATGGATGTATCAATTCCTAAAAAGCATCTATATAGATGTAATATTTCGACAAGA
ATTATGAAACGGAGGGAGTACTAATTTTGTATCAGTGACTAGTCTGTGCCGACACCAAAGCACCCAAGTCGCATCTCGAAGGTATTGAGTTACTGTTAGTCCTAGCCTCCTAGGAATATG
GGTGTGGATAGATAGACCCTTACTAAAGTACAGTGTCACAAACATCTACTTTTAGCTAAATCCATCGAAGTCAGATAGATCTGAACAAGAAGCAGCATACAGTCAGTTAGCATAATTTTA
TTCCCCCTGATGATGATTACTCTGTATACACAACATAAAGATCACTCATAGCTCACTCTCAGTACACAGGTCAAATTTGGTTAACAGCATAAATTCTCCTGAAAGTTCCAATTTGTATAA
CGAACTTGCATTTAGCTCAAAATACCATGAAAGAACACGCATGTTAACAAAAAGCAAAAGAGGAACCAGCATATCATGTCTATGATTAATTCTAATGCAACGTAAAGTTCATGCTCACCA
ATATTTGTGAGGTGACCCAATCTTATCAAACACCATTATTATATGCCACAGGGTTGCGACGGCTCAGTCCTGATCGACTCAACTGCAAACAACACTGCTGAGAAGGACGCAATCCCCAAC
AACCCCAGTCTCCGCGGGTTTGAGGTTATTGATGCTGCAAAGAAGGCCATTGAGGCCAAATGCCCCAAGATAGTCTCATGCGCTGACATCCTTGCCTTTGCCGCCCGAGACAGCATAGCA
CTAGCAGGTAATGTTACTTACAAGGTGCCTGCTGGTCGCCGTGATGGCAGGATATCCAGTGACCAGAATGCCCTGAACAACCTCCCCTCGCCGCTCTCAACGGCATCTGAGCTGGTAGGC
AACTTCACCTTGAAGAATCTCACAGCTGAGGACATGGTCGTCCTCTCCGGTGCCCACACGATAGGTGTCTCGCGCTGCTCGTCCTTCACGAACAGGCTATATGGCTTCAGCAACACCAGT
CAG
GTATAACGTGTTCAAATCTACAGCAGTTTTCAGACATTTTCTTTTGGAGCATATGGTATGCATCTAGCCTTTCTTCCCCTAAATGATTATCTCTGCTACCAGGTTGATCCTACAATG
AGCTCTGCCTATGCTTTCCTGCTCAAGAACATATGCCCTGCCAACAGCAGCCAGTTCTTCCCAAACACAACGATGGATATGGATATCATCACCCCCGCGGTGCTTGACAATAAGTATTAT
GTGAGTCTGATAAACAACCTAGGCCTATTTACGTCAGACCAAGCATTACTCACAAACTCAACTCTGAAAGCATCAGTGGACGAGTTTGTGAAGAACGAAAATAGATGGAAGAGCAAGTTT
GTCAAGTCCATGGTTAAGATGGGGAACATTGAGGTGCTAACAGGAACACAAGGAGAGATTAGGCTCAACTGCAGGGTCATAAACAAAGGGAGCACTGGTCTTGAGTTTAATTCTGGTATC
AACTCTGGTGAATTCACTGAAATAGCAACAAGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTCCCTCGCCATGAACTCCCTGCTCGCCACCTTGGCAGTTGCCGTCCTTGCCCTCTTCCCGATTGCTGCTGTCGGAGCTGGCCTGAAGGTCGGGTTCTACAGCAAGACCTGCCCA
TCCGCGGAGACCCTGGTGCAGCAGGCAGTGGCTGCTTCCTTCAAGAATAACGGTGGTGTCGCTGCTGGCCTCATCCGATTGCATTTCCACGACTGCTTTGTGAAA
GGTTGCGACGGCTCA
GTCCTGATCGACTCAACTGCAAACAACACTGCTGAGAAGGACGCAATCCCCAACAACCCCAGTCTCCGCGGGTTTGAGGTTATTGATGCTGCAAAGAAGGCCATTGAGGCCAAATGCCCC
AAGATAGTCTCATGCGCTGACATCCTTGCCTTTGCCGCCCGAGACAGCATAGCACTAGCAGGTAATGTTACTTACAAGGTGCCTGCTGGTCGCCGTGATGGCAGGATATCCAGTGACCAG
AATGCCCTGAACAACCTCCCCTCGCCGCTCTCAACGGCATCTGAGCTGGTAGGCAACTTCACCTTGAAGAATCTCACAGCTGAGGACATGGTCGTCCTCTCCGGTGCCCACACGATAGGT
GTCTCGCGCTGCTCGTCCTTCACGAACAGGCTATATGGCTTCAGCAACACCAGTCAG
GTTGATCCTACAATGAGCTCTGCCTATGCTTTCCTGCTCAAGAACATATGCCCTGCCAACAGC
AGCCAGTTCTTCCCAAACACAACGATGGATATGGATATCATCACCCCCGCGGTGCTTGACAATAAGTATTATGTGAGTCTGATAAACAACCTAGGCCTATTTACGTCAGACCAAGCATTA
CTCACAAACTCAACTCTGAAAGCATCAGTGGACGAGTTTGTGAAGAACGAAAATAGATGGAAGAGCAAGTTTGTCAAGTCCATGGTTAAGATGGGGAACATTGAGGTGCTAACAGGAACA
CAAGGAGAGATTAGGCTCAACTGCAGGGTCATAAACAAAGGGAGCACTGGTCTTGAGTTTAATTCTGGTATCAACTCTGGTGAATTCACTGAAATAGCAACAAGCTAG

Retrieve as FASTA