Entry information : AalpPrx62
Entry ID 9639
Creation 2011-11-01 (Christophe Dunand)
Last sequence changes 2015-02-02 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: AalpPrx62
Name AalpPrx62
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Arabis
Organism Arabis alpina    [TaxId: 50452 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AalpPrx62
start..stop
S start..stop
BstrPrx31 591 0 1..318 1..318
BrPrx62-1Aa_other 575 0 1..318 1..318
AlyPrx62 572 0 1..318 1..318
CrubPrx82 564 0 1..318 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35165729..35166227 499 N° 2 35165235..35165397 163 N° 3 35164358..35164761 404  
complement(join(35164358..35164761,35165235..35165397,35165729..35166227))


exon

Literature and cross-references AalpPrx62
DNA ref. GenBank:   CM002874.1 (35166227..35164358)
Protein sequence: AalpPrx62
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (296)
PWM (Da):   %s   34402.24 (32080.0)  
PI (pH):   %s   8.67 (8.60) Peptide Signal:   %s   cut: 23 range:23-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGIVRSLCSFIVLLSSLIAVYGQGTRIGFYSTTCPNAETIVRTTVTSHFGSDPKIAPGLLRMHFHDCFVQGCDGSVLISGPNTERTAGANFNLRGFEVIDDAKRQLEAACPGVVSCADILTLAARDSIALTKGQSWQVPTGRRDGRVSLATNINNLPSPSDSVAIQQRKFASFRLNTRDLVALVGGHTIGTTACGFFTNRIFNMTGNTADPIMDQTFVPQLQRLCPQNNDGSNRVDLDAGSGNTFDTSFFNNLSRGRGILQSDHVLWTNPTTRRIVQEFMASRATFNDQFARSMIKMSNIGVKTGANGEIRWVCTAIN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCATTGTCCGATCATTATGCTCGTTTATAGTCCTCCTTAGCTCTCTCATCGCGGTTTACGGTCAAGGTACAAGGATCGGGTTCTACTCGACTACCTGCCCTAATGCCGAGACGATT
GTTCGGACCACCGTGACATCTCATTTCGGTTCGGATCCAAAGATTGCACCCGGGTTACTAAGAATGCACTTCCACGATTGCTTCGTCCAAGGTTGTGATGGTTCAGTACTTATATCAGGA
CCTAACACTGAAAGAACCGCGGGTGCAAACTTTAACCTTCGTGGTTTTGAGGTTATTGACGACGCCAAGAGACAGCTTGAGGCCGCATGTCCTGGTGTTGTCTCATGTGCTGATATTTTA
ACTTTAGCCGCTCGTGATTCTATCGCNNNNNNNNNNTGAGGTTATTGACGACGCCAAGAGACAGCTTGAGGCCGCATGTCCTGGTGTTGTCTCATGTGCTGATATTTTAACCTTAGCCGC
TCGTGATTCTATCGCCCTC
GTAAGTATATACGTACAAAGGAAATAAGTACTATGTTTCAATTGTTCTAATACTCTCTCTTTTTGCGTTTACATTTAGAATTGAATTTTTTAGGTCGAAGT
ACTAAAATTTTAGATTAATGTAAAAATATAAATCTTGACCAAAGTGAAATAGTACATTCATATTAAAACAAAATTTGGCATTTTACTTGGTACTCTATCCTCTTCTTTTTTTGTTCAACA
CTCGTTACTCTGTCTATAATACTAAATTAGTATCGGTCAAAGTGGTTTAAATACAAAAATGTAGGATAAGTCATTAAAGTTTTACGTGGCCTTGCATGGGTGCAATATAGACGAAAGGAC
AAAGCTGGCAAGTACCAACAGGACGTAGAGATGGACGAGTTTCCTTGGCAACGAACATTAACAATCTTCCCTCTCCAAGTGACTCTGTCGCCATTCAACAAAGGAAATTCGCCTCTTTTC
GCCTCAACACTCGCGATCTCGTCGCTCTTGTTG
GTTAGCTAATTTTACAAAATTCATGACTCTAGATTTCTCATATATATCATCGTTTACAGATTATAACAAATCCAATATATATATTGA
TTTGGATGGGAACTCCTTGTGTTCACTTTTGTTTTAAAGACTTTAGTATTCACATTTCGATTTCCTCATATATATATATATATATATAATTGTTTATTTATTTATTTATTAGTTTAAGAA
AATAGGTATCAAAGTATATAGTATGAATCGGCTATATATAATGACCATTGTTTTCGTTTCAATCAAATATTGTCTTAATTCTTGAGAAAATCAAGATTCTGTTTTTCCCCTCTCGGATTC
GTATCTTTTAGATGTAGAAGGGAAAAAAAAGTACACTATTCTCAATTTATCCGTACTAAAGCTCAACTCTGTTTTTTGTTTGACTTTTTTCTTCTTTTTCAGTTCGAAGTATTTAGGCTA
ACAATATAAGAATATATGATTCATAGGAGGACACACGATTGGAACAACTGCATGTGGGTTCTTCACGAATAGGATATTCAATATGACCGGAAACACAGCAGATCCAATCATGGACCAAAC
GTTCGTACCACAGCTTCAAAGACTTTGCCCTCAAAACAACGACGGATCAAATCGCGTAGATCTTGACGCCGGAAGTGGAAACACTTTTGACACATCTTTCTTTAACAATCTCAGTCGTGG
TAGAGGAATTCTTCAATCCGATCATGTTCTTTGGACTAACCCGACGACTAGACGGATAGTGCAAGAGTTTATGGCATCTAGAGCTACCTTCAATGACCAGTTCGCAAGGTCTATGATTAA
GATGAGTAATATTGGTGTGAAGACAGGGGCGAATGGAGAAATTCGTTGGGTTTGTACAGCTATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCATTGTCCGATCATTATGCTCGTTTATAGTCCTCCTTAGCTCTCTCATCGCGGTTTACGGTCAAGGTACAAGGATCGGGTTCTACTCGACTACCTGCCCTAATGCCGAGACGATT
GTTCGGACCACCGTGACATCTCATTTCGGTTCGGATCCAAAGATTGCACCCGGGTTACTAAGAATGCACTTCCACGATTGCTTCGTCCAAGGTTGTGATGGTTCAGTACTTATATCAGGA
CCTAACACTGAAAGAACCGCGGGTGCAAACTTTAACCTTCGTGGTTTTGAGGTTATTGACGACGCCAAGAGACAGCTTGAGGCCGCATGTCCTGGTGTTGTCTCATGTGCTGATATTTTA
ACTTTAGCCGCTCGTGATTCTATCGCNNNNNNNNNNTGAGGTTATTGACGACGCCAAGAGACAGCTTGAGGCCGCATGTCCTGGTGTTGTCTCATGTGCTGATATTTTAACCTTAGCCGC
TCGTGATTCTATCGCCCTC
ACGAAAGGACAAAGCTGGCAAGTACCAACAGGACGTAGAGATGGACGAGTTTCCTTGGCAACGAACATTAACAATCTTCCCTCTCCAAGTGACTCTGTCGC
CATTCAACAAAGGAAATTCGCCTCTTTTCGCCTCAACACTCGCGATCTCGTCGCTCTTGTTG
GAGGACACACGATTGGAACAACTGCATGTGGGTTCTTCACGAATAGGATATTCAATAT
GACCGGAAACACAGCAGATCCAATCATGGACCAAACGTTCGTACCACAGCTTCAAAGACTTTGCCCTCAAAACAACGACGGATCAAATCGCGTAGATCTTGACGCCGGAAGTGGAAACAC
TTTTGACACATCTTTCTTTAACAATCTCAGTCGTGGTAGAGGAATTCTTCAATCCGATCATGTTCTTTGGACTAACCCGACGACTAGACGGATAGTGCAAGAGTTTATGGCATCTAGAGC
TACCTTCAATGACCAGTTCGCAAGGTCTATGATTAAGATGAGTAATATTGGTGTGAAGACAGGGGCGAATGGAGAAATTCGTTGGGTTTGTACAGCTATTAATTAA

Retrieve as FASTA