Entry information : PoVP04_PC15 (MnP-short)
Entry ID 9641
Creation 2011-11-01 (Christophe Dunand)
Last sequence changes 2011-11-17 (Christophe Dunand)
Sequence status complete
Reviewer Catherine Mathe
Last annotation changes 2016-06-10 (Catherine Mathe)
Peroxidase information: PoVP04_PC15 (MnP-short)
Name (synonym) PoVP04_PC15 (MnP-short)
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoVP04_PC15
start..stop
S start..stop
PoVP04_PC9 710 0 1..357 1..357
PsaVP01 545 0 1..354 1..358
PoVP06_PC9 542 0 1..344 1..344
PoVP06_PC15 542 0 1..344 1..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1842121..1842181 61 N° 2 1841941..1842068 128 N° 3 1841824..1841882 59 N° 4 1841640..1841774 135
N° 5 1841463..1841584 122 N° 6 1841334..1841409 76 N° 7 1841245..1841281 37 N° 8 1841180..1841187 8
N° 9 1841042..1841122 81 N° 10 1840916..1840985 70 N° 11 1840852..1840861 10 N° 12 1840759..1840794 36
N° 13 1840530..1840702 173 N° 14 1840434..1840473 40 N° 15 1840354..1840378 25 N° 16 1840283..1840307 25
complement(join(1840283..1840307,1840354..1840378,1840434..1840473,1840530..1840 702,1840759..1840794,1840852..1840861,1840916..1840985,1841042..1841122,1841180. .1841187,1841245..1841281,1841334..1841409,1841463..1841584,1841640..1841774,184 1824..1841882,1841941..1842068,1842121..1842181))


exon

Literature and cross-references PoVP04_PC15 (MnP-short)
DNA ref. JGI genome:   scaffold_05 (1842183..1840285)
Cluster/Prediction ref. JGI gene:   199511
Protein sequence: PoVP04_PC15 (MnP-short)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (340)
PWM (Da):   %s   37526.75 (35452.6)  
PI (pH):   %s   4.24 (4.24) Peptide Signal:   %s   cut: 22 range:22-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTFSGLSSLILALGAVQLSNAASIKRATCADGNTVTNAACCVLFPILEDIQTNLFDGGECGEVHESLRLTFHDAIGFSPSRGGGGADGSLITFSEIETPFHANLGIDEIVEAQKPFVAKHNISAGDFIQFAGAVGVSNCPGAPRLQFFLGRPDAVAPAPDLTVPEPDSVDSILARFADAGFSPAEVVALLASHTIAAADNVDPIPGTPFDSTPSAFDSQFFVETQLRGTSFPGTAGNQGEVESPLRGEMRLQSDSLARDPRTACEWQSFVNNQSKLQSAFKAAMLKLSLVAQDKSKLVDCSDVIPVPPTLNAAAHFPAGLTKNDVEQCAATPFPALTTDPGPVTAVPPVIPALLPK

Retrieve as FASTA  
Remarks Complete sequence from genomic (15 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACATTCTCTGGACTCTCTTCTCTGATCTTGGCTCTCGGCGCTGTGCAGCTCTCGAATGGTAGGTAACCTCCTCTTTCGAATGCTTCACGGAACTCATTAATATCCTTTAGCTGCCTC
GATTAAGCGTGCTACATGCGCAGATGGCAACACTGTCACTAATGCTGCTTGCTGCGTCTTGTTCCCAATTTTGGAGGACATCCAGACCAACCTCTTCGACGGTGGAGAGTGCGGTGAAGA
G
GTACAGTTTCATTGGCACCTACCCCTCACACCAGGGCGCCATCTCAAATCTTGGGCAGGTTCATGAGTCACTCCGTCTGACTTTCCACGACGCTATTGGGTTCTCTCCCAGCCGAGGGT
ATGCCTTAAAAGCTCTTACGCTATTTGATATTGACTAGGGGCGACAGTGGTGGAGGAGCTGATGGCTCCTTGATCACCTTCAGCGAGATCGAAACTCCATTCCATGCGAACCTTGGTATC
GACGAAATCGTCGAAGCTCAGAAGCCTTTCGTCGCGAAGCATAACATCTCAGCAGGTGACTT
GTATGTCAACCAACGCAGCATAACCAGCACGACTTTATCTTACCTCGACTTCTAGCAT
CCAGTTCGCTGGAGCTGTTGGTGTTAGTAACTGCCCTGGCGCTCCGCGACTACAATTCTTCCTGGGTCGCCCCGACGCCGTAGCTCCAGCGCCAGACCTGACGGTTCCTGAGCCATTTG
G
TGGGTCATAGAACGAGATGGACGATCAACGTATTCACTAGACCACCCTCTAGACTCGGTGGACAGCATCCTTGCGAGGTTTGCTGACGCTGGCTTCTCGCCTGCTGAAGTCGTTGCCTTG
TTGGCTTC
GTGAGCATCGCGAAAATTGGACTTCAAAAACCTCGACTAATTTAATCCGTAGTCACACCATCGCTGCCGCCGACAATGTTGACCCAACGGTATGTCAGCTCAATCACTCCGT
TCCGTCTATATTCTGACGGCCCTGGTCCCTATAGATTCCTGGGTATGTCTATATGCTCCCTAGGAATCGATGAGAAAGTACTTACCTAGTCACTGACAGAACGCCATTCGACTCGACTCC
TTCAGCTTTCGATTCCCAGTTCTTCGTTGAGACCCAGCTCCGCGGGACAAGCTTCCCAGG
GTAATTATAATCTCTCCAATGCGTTGCCCTGGTATTGGTTCTGAACACACTTTTAGTACT
GCCGGAAACCAGGGCGAAGTTGAATCTCCCCTTCGAGGAGAGATGCGGCTTCAGTCTGACTCCGAG
GTATGTGGGTCACTTTCCATCTCACGGCGGGATTAATCACGTTCTGCCTTATAG

CTTGCCCGAG
GTAAGAATACCAGTGATCGCGACCCAGCTTTCCGCTAAATCCTTGGGGTTTCCACAGATCCCAGAACCGCATGCGAATGGCAGTCGTTTGTCAGTAAGTGTTAAAGACAT
GTTATGTTTGCACAGGAGCAACAATGAACCGCTGTACAGACAATCAATCCAAGTTGCAATCTGCGTTTAAGGCCGCGATGTTGAAACTGTCTTTGGTCGCCCAGGACAAGAGCAAGCTGG
TCGACTGTTCTGACGTGATCCCTGTTCCTCCAACACTGAACGCAGCCGCACATTTCCCAGCTGGACTTACCAAGAATGACGTCGAGCAAGCC
GTGCGTGCAGATTCCTTGTCTGCTACAT
CTGATTTGTTAATTGTTTGCTCTTTCAGTGCGCTGCTACTCCTTTCCCCGCTTTGACTACTGACCCTGGTTCGTATCTATGTTTCCCGGGAGCTATACATGTCTTGCTAACATTCTTCTG
CAGGTCCAGTCACTGCCGTCCCGCCCGTGTGAGTACCTGAATCCAAGCAATTTTGTATGAAACTGATGCATCAGCATTCCAGCCCTCCTTCCTAAATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACATTCTCTGGACTCTCTTCTCTGATCTTGGCTCTCGGCGCTGTGCAGCTCTCGAATGCTGCCTCGATTAAGCGTGCTACATGCGCAGATGGCAACACTGTCACTAATGCTGCTTGC
TGCGTCTTGTTCCCAATTTTGGAGGACATCCAGACCAACCTCTTCGACGGTGGAGAGTGCGGTGAAGAG
GTTCATGAGTCACTCCGTCTGACTTTCCACGACGCTATTGGGTTCTCTCCC
AGCCGAGG
TGGTGGAGGAGCTGATGGCTCCTTGATCACCTTCAGCGAGATCGAAACTCCATTCCATGCGAACCTTGGTATCGACGAAATCGTCGAAGCTCAGAAGCCTTTCGTCGCGAAG
CATAACATCTCAGCAGGTGACTT
CATCCAGTTCGCTGGAGCTGTTGGTGTTAGTAACTGCCCTGGCGCTCCGCGACTACAATTCTTCCTGGGTCGCCCCGACGCCGTAGCTCCAGCGCCA
GACCTGACGGTTCCTGAGCCATTTG
ACTCGGTGGACAGCATCCTTGCGAGGTTTGCTGACGCTGGCTTCTCGCCTGCTGAAGTCGTTGCCTTGTTGGCTTCTCACACCATCGCTGCCGCC
GACAATGTTGACCCAACG
ATTCCTGGAACGCCATTCGACTCGACTCCTTCAGCTTTCGATTCCCAGTTCTTCGTTGAGACCCAGCTCCGCGGGACAAGCTTCCCAGGTACTGCCGGAAAC
CAGGGCGAAGTTGAATCTCCCCTTCGAGGAGAGATGCGGCTTCAGTCTGACTCCGAG
CTTGCCCGAGATCCCAGAACCGCATGCGAATGGCAGTCGTTTGTCAACAATCAATCCAAGTTG
CAATCTGCGTTTAAGGCCGCGATGTTGAAACTGTCTTTGGTCGCCCAGGACAAGAGCAAGCTGGTCGACTGTTCTGACGTGATCCCTGTTCCTCCAACACTGAACGCAGCCGCACATTTC
CCAGCTGGACTTACCAAGAATGACGTCGAGCAAGCC
TGCGCTGCTACTCCTTTCCCCGCTTTGACTACTGACCCTGGTCCAGTCACTGCCGTCCCGCCCGTCATTCCAGCCCTCCTTCCT
AAATAA

Retrieve as FASTA