Entry information : CsuCIIBA
Entry ID 9653
Creation 2011-11-04 (Christophe Dunand)
Last sequence changes 2011-11-04 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-26 (Nizar Fawal)
Peroxidase information: CsuCIIBA
Name CsuCIIBA
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Coriolaceae Ceriporiopsis
Organism Ceriporiopsis subvermispora    [TaxId: 42742 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value CsuCIIBA
start..stop
S start..stop
LsulCIIBA01 395 4e-138 20..342 22..344
WcoCIIBA 372 2e-129 19..342 6..330
PplCIIBA 342 1e-117 43..341 14..312
FpinCIIBA 342 3e-117 16..310 2..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1563886..1563961 76 N° 2 1563795..1563826 32 N° 3 1563721..1563738 18 N° 4 1563648..1563673 26
N° 5 1563488..1563592 105 N° 6 1563410..1563423 14 N° 7 1563308..1563349 42 N° 8 1563176..1563254 79
N° 9 1562830..1563124 295 N° 10 1562636..1562780 145 N° 11 1562413..1562579 167 N° 12 1562281..1562361 81
complement(join(1562281..1562361,1562413..1562579,1562636..1562780,1562830..1563 124,1563176..1563254,1563308..1563349,1563410..1563423,1563488..1563592,1563648. .1563673,1563721..1563738,1563795..1563826,1563886..1563961))


exon

Literature and cross-references CsuCIIBA
DNA ref. JGI genome:   scaffold_3 (1563961..1562281)
Protein sequence: CsuCIIBA
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   359
PWM (Da):   %s   38307.92 Transmb domain:   %s   i7-29o
PI (pH):   %s   5.98
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRESSKLQYTTLIICVIRLCSTFCSAFVISNSLNACLSWFGVLDDIQTNMFGGGTCNDLARAAIRLTFHDGIGRSMALSNSGEFGGEGDGSIITFSRTELSYPANKGLELIVDALGHFADAHGVSYGDIIQFAGAVATSNCPGAPRLPFHAGRPNAIAPSPPDLVPSPSDSVEMILARMSDAGLTTEDTIALLAAHSVGKQRTLDLNITGMPFDTTPDAFDTQFYLTSLRGTVMPGPGRSDFEVKSPSKDEFRIASDAAFARHPLTACVWQSFVVNQSRLQGSFSQAMIKLANAGHSNLIDCSIAIPPSRSWSRLPVYPPGKSRSDIDHCSTTAFPDIPSDWVPVAHHIPFSRLM*

Retrieve as FASTA  
Remarks Complete sequence from genomic (
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGGAGTCATCAAAGTTGCAATACACGACGCTCATTATTTGCGTCATTCGCCTATGTAGCACTTTTTGCTCAGGTACGGATACCCATCTCGGAGTAAAAGTGTACACTGCAGTGTGT
TGACCAGCCGTATAGCGTTCGTGATCTCCAACTCCTTGAACGCAACAGTGAGTTTGTTGCGCTCGGTTTCTGTCACGTGAATATCTGAACCATGCATGCGCAGTGCCTAAGCTGGTTTGG
C
GTAAGGTCGTTCTCGTTTTCAAAAGGTGTTCTGAGGAAAGTTCGCAGGTGCTGGACGACATACAAACCAATATGTGAGTGTTTGCATCAACCTACACCACGAGCCTCGAAATAAGAACG
CAGATGAAGGTTTGGCGGAGGAACATGCAATGACCTGGCGCGGGCCGCCATAAGATTGACATTTCACGATGGCATAGGGCGATCTATGGCGCTGAGCAATTCCGGAGAGTTCGGGTGATT
ATTTCATTGGGTTAGTGGCTACCGCCTGGATGTTCTGACAAAATCGGTGGATGTATAGCGGCGAAGGCGCAGGTACGTTCATTTCAGGCCGTTGGATAGTCCGGTGAAACGTATCGTGAG
TGCCTCCTTTAGATGGCAGTATCATCACATTTTCCAGGACTGAGTTGTCATACCGTGAGACATGACGTGCACCTGACACCTATATTGAGTCTGACATCTTCGTACAGCCGCCAACAAAGG
CTTGGAACTGATTGTAGACGCTCTGGGACATTTCGCAGACGCCCATGGTGTCAGTTACGGGGATAT
GTAAGCCGGATTCATCCGTCGGGACGTCGCTGACTGGCTGAGGTCCTTCAGTAT
ACAGTTTGCAGGGGCGGTAGCTACTTCGAATTGCCCTGGTGCCCCACGACTTCCTTTCCACGCTGGACGTCCGAACGCCATCGCACCATCGCCGCCCGATCTCGTTCCGTCTCCTTCGGA
TTCTGTCGAGATGATTCTAGCTCGCATGTCTGACGCTGGTCTCACAACAGAAGACACTATTGCCCTTCTCGCGGCACATTCCGTTGGCAAGCAGAGAACGCTGGATCTCAACATCACCGG
CATGCCATTCGATACCACTCCAGATGCTTTTGACACACAATTTTACCTTGAC
GTGAGCGTCTCTGTCTCAACTTCTATGCCGATGCTCACAGTAAATATAGACGTCATTACGTGGCACGG
TCATGCCCGGTCCTGGCAGAAGTGATTTTGAAGTTAAATCTCCTTCGAAAGACGAATTTCGAATCGCTTCAGATGCCGCATTCGCACGACATCCCTTGACCGCATGTGTATGGCAGTCAT
TCGTTG
GTAGGCCGTCCACTAGATGGCATAGACCTTCGTTACTCAAGCATGACCTGGCTCAGTGAACCAAAGCAGGCTACAAGGCTCATTCTCACAAGCCATGATCAAATTGGCTAATGC
GGGTCATTCGAACTTAATTGATTGCTCTATTGCCATACCGCCCTCGCGCTCATGGTCCCGGCTGCCCGTGTATCCTCCCGGAAAGAGCCGATCGGATATCGATCACTCG
GTCCGTGCTCC
TGACCCGCTTGACTGTGCTCAAAGCTTATGTAGAGCTTAGTGTTCCACGACAGCCTTCCCAGATATTCCATCGGATTGGGTGCCTGTCGCACACCACATACCATTCTCACGCCTAATGTG
A

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCGGGAGTCATCAAAGTTGCAATACACGACGCTCATTATTTGCGTCATTCGCCTATGTAGCACTTTTTGCTCAGCGTTCGTGATCTCCAACTCCTTGAACGCAACATGCCTAAGCTGG
TTTGGC
GTGCTGGACGACATACAAACCAATATGTTTGGCGGAGGAACATGCAATGACCTGGCGCGGGCCGCCATAAGATTGACATTTCACGATGGCATAGGGCGATCTATGGCGCTGAGC
AATTCCGGAGAGTTCGG
CGGCGAAGGCGCAGATGGCAGTATCATCACATTTTCCAGGACTGAGTTGTCATACCCCGCCAACAAAGGCTTGGAACTGATTGTAGACGCTCTGGGACATTTC
GCAGACGCCCATGGTGTCAGTTACGGGGATAT
TATACAGTTTGCAGGGGCGGTAGCTACTTCGAATTGCCCTGGTGCCCCACGACTTCCTTTCCACGCTGGACGTCCGAACGCCATCGCA
CCATCGCCGCCCGATCTCGTTCCGTCTCCTTCGGATTCTGTCGAGATGATTCTAGCTCGCATGTCTGACGCTGGTCTCACAACAGAAGACACTATTGCCCTTCTCGCGGCACATTCCGTT
GGCAAGCAGAGAACGCTGGATCTCAACATCACCGGCATGCCATTCGATACCACTCCAGATGCTTTTGACACACAATTTTACCTTGAC
ACGTCATTACGTGGCACGGTCATGCCCGGTCCT
GGCAGAAGTGATTTTGAAGTTAAATCTCCTTCGAAAGACGAATTTCGAATCGCTTCAGATGCCGCATTCGCACGACATCCCTTGACCGCATGTGTATGGCAGTCATTCGTTG
TGAACCAA
AGCAGGCTACAAGGCTCATTCTCACAAGCCATGATCAAATTGGCTAATGCGGGTCATTCGAACTTAATTGATTGCTCTATTGCCATACCGCCCTCGCGCTCATGGTCCCGGCTGCCCGTG
TATCCTCCCGGAAAGAGCCGATCGGATATCGATCACTCG
TGTTCCACGACAGCCTTCCCAGATATTCCATCGGATTGGGTGCCTGTCGCACACCACATACCATTCTCACGCCTAATGTGA

Retrieve as FASTA