Entry information : PgigCIIBA01 ( GP)
Entry ID 9662
Creation 2011-11-09 (Christophe Dunand)
Last sequence changes 2016-02-16 (Catherine Mathe)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-16 (Christophe Dunand)
Peroxidase information: PgigCIIBA01 ( GP)
Name (synonym) PgigCIIBA01 ( GP)
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Phanerochaetaceae Phlebiopsis
Organism Phlebiopsis gigantea    [TaxId: 82310 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PgigCIIBA01
start..stop
S start..stop
CuniCIIBA03 329 2e-112 12..313 28..327
PcCIIBA01 323 3e-111 5..310 8..312
ParcCIIBA04 311 1e-105 14..309 21..315
GsppCIIBA06 308 3e-104 7..313 15..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13195..13290 96 N° 2 13339..13382 44 N° 3 13441..13474 34 N° 4 13526..13539 14
N° 5 13590..13634 45 N° 6 13728..13795 68 N° 7 13849..13927 79 N° 8 13978..14218 241
N° 9 14270..14323 54 N° 10 14378..14496 119 N° 11 14552..14580 29 N° 12 14640..14761 122
join(13195..13290,13339..13382,13441..13474,13526..13539,13590..13634,13728..137 95,13849..13927,13978..14218,14270..14323,14378..14496,14552..14580,14640..14761 )


exon

Literature and cross-references PgigCIIBA01 ( GP)
DNA ref. JGI genome:   scaffold_332 (13195..14761)
Protein sequence: PgigCIIBA01 ( GP)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314
PWM (Da):   %s   34145.57  
PI (pH):   %s   4.5
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLALYTLFVAAVPNADNAVRCGAGRFAAHSECCNWFDVLDDVQETLFEGRCDDEARSIRIQFHDAISYSKGLGSAGRYLHSLSVDGSILSHADLELTAENTGLDNIVWAQRALAVKHGVSFGDFITFAGAVGLSNCHDAPRLRFFAGRQNSTAPAPDGLVPAPWHSVDRILARMADAGFSPEETIALLAAHSVATQHTIDPMAGAALDSTPESFDNRFFTEMLLDSSERAPANDTVKGVVDSPFRDQLRLQSDYLMARDERTAPTWQSLRDTSQMSSRFVEAMAKLSMLGQDPSTLVDCSDVIPQRDRN

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns). Missing residues in 3'.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCTAGCTCTGTACACACTCTTCGTTGCGGCGGTGCCGAACGCGGATAATGCCGTGCGGTGCGGCGCGGGACGCTTCGCTGCACACTCCGAAGTATGTTATCCTGTCTAGGCCTTG
AGTGTTATGCTGATATATGCAAAGTGCTGTAATTGGTTTGATGTCCTAGATGACGTACAAGAAACGCTGTGCGTATATTTTAGGGAGTGAGTTGGTCTTGGCTGACAAGTTTCTTCGCAT
AAACAGGTTTGAAGGGCGCTGCGACGACGAAGCACGAGAAGTGCGTCGATCCTGACTGCCTCAATGTAACCCCTATTAACATCGGCTGTAGTCCATACGCATACAGTAAGCGTGACTCCG
GACTTATCTGCTACAAATTATGACCATTACGGTAGATTCCACGACGCGATATCCTATTCCAAAGGGCTTGGCTCGGCTGGGTTCGTAGTCTTGCTTTTATATGATGTGACGCTGTTGATA
TTGACTCTCTGGTTCCAGAGGCGGTGGTGCTGGTATGTTCCTTGCATGGAGAGCCGCTACCTGCACTCACTTTCCGTAGATGGCTCGATCCTAAGTCACGCCGATTTGGAGCTCACGTAT
G
GTATCACAACAATCGTTCTCTTCTGAGATGTCGAATCTAACTCTAACTCCAAGCCGAGAATACGGGCCTAGACAATATCGTCTGGGCACAACGCGCGCTGGCCGTTAAACACGGTGTAT
CCTTCGGCGACTT
GTGGGTGGTCTCCGCCGTAAAATGCGTAGCTTTCATGAACGTCCTCACAGTATCACCTTCGCGGGTGCCGTGGGCTTGTCCAACTGCCACGATGCGCCTCGACTGCG
ATTCTTCGCCGGCCGGCAGAATTCTACCGCTCCCGCTCCAGACGGGCTCGTGCCTGCCCCATGGCACTCAGTCGACCGCATCCTTGCTCGGATGGCCGACGCGGGGTTTTCACCAGAAGA
GACCATCGCTCTGCTCGCAGCCCACAGCGTTGCGACTCAGCATACGATCGATCCTATGGCCGAC
GTATGTCGCAGTTTCTCGGTAGATCTTAAACCCAACTTACATCGTGTATAGGGCGC
CGCTTTGGATTCTACCCCTGAATCGTTCGATAACCGGTTCTTCACGGAG
GTTTGTCCAGGTTGTCAAGTGGTCGAGAGATTGATGAACCCACACGATCGTCAGATGTTGCTCGACTCCTC
CGAAAGAGCACCCGCGAACGACACCGTCAAAGGAGTGGTTGACTCTCCATTTCGTGATCAACTACGACTTCAGTCAGACTACTTGATGGCCCGGGATGAAAG
GTGCGTTGACTTACGTTG
CTCCATAGGGATGAGCTTTAACGACGTCAAACATCAGGACTGCACCCACATGGCAATCACTCAGTCGTACGTACTTGACGTGTACCTCATGTGTCTCGCCGATGCTCATATCCAGTTCTA
TCCAGGTGATACAAGCCAGATGTCGAGTCGCTTCGTAGAGGCCATGGCTAAGCTCTCCATGCTGGGCCAAGACCCTTCGACTTTGGTCGATTGTTCTGATGTCATACCGCAACGAGATCG
TAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCTCTAGCTCTGTACACACTCTTCGTTGCGGCGGTGCCGAACGCGGATAATGCCGTGCGGTGCGGCGCGGGACGCTTCGCTGCACACTCCGAATGCTGTAATTGGTTTGATGTCCTA
GATGACGTACAAGAAACGCT
GTTTGAAGGGCGCTGCGACGACGAAGCACGAGAATCCATACGCATACAATTCCACGACGCGATATCCTATTCCAAAGGGCTTGGCTCGGCTGGCCGCTAC
CTGCACTCACTTTCCGTAGATGGCTCGATCCTAAGTCACGCCGATTTGGAGCTCACGTATG
CCGAGAATACGGGCCTAGACAATATCGTCTGGGCACAACGCGCGCTGGCCGTTAAACAC
GGTGTATCCTTCGGCGACTT
TATCACCTTCGCGGGTGCCGTGGGCTTGTCCAACTGCCACGATGCGCCTCGACTGCGATTCTTCGCCGGCCGGCAGAATTCTACCGCTCCCGCTCCAGAC
GGGCTCGTGCCTGCCCCATGGCACTCAGTCGACCGCATCCTTGCTCGGATGGCCGACGCGGGGTTTTCACCAGAAGAGACCATCGCTCTGCTCGCAGCCCACAGCGTTGCGACTCAGCAT
ACGATCGATCCTATGGCCGAC
GGCGCCGCTTTGGATTCTACCCCTGAATCGTTCGATAACCGGTTCTTCACGGAGATGTTGCTCGACTCCTCCGAAAGAGCACCCGCGAACGACACCGTC
AAAGGAGTGGTTGACTCTCCATTTCGTGATCAACTACGACTTCAGTCAGACTACTTGATGGCCCGGGATGAAAG
GACTGCACCCACATGGCAATCACTCAGTCGTGATACAAGCCAGATG
TCGAGTCGCTTCGTAGAGGCCATGGCTAAGCTCTCCATGCTGGGCCAAGACCCTTCGACTTTGGTCGATTGTTCTGATGTCATACCGCAACGAGATCGTAATTGA

Retrieve as FASTA