Entry information : SbPrx11 (Sobic.001G293200.1[2.1]Sb01g028640[1.4])
Entry ID 967
Creation 2005-12-26 (Christophe Dunand)
Last sequence changes 2011-01-24 (Toky Ramarohetra)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-01 (Messaoudi)
Peroxidase information: SbPrx11 (Sobic.001G293200.1[2.1]Sb01g028640[1.4])
Name (synonym) SbPrx11 (Sobic.001G293200.1[2.1]Sb01g028640[1.4])
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type Seedlings
Inducer Phosphate starvation
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx11
start..stop
S start..stop
SiPrx158 582 0 1..330 1..329
SbPrx09 509 0 13..330 14..331
ZmPrx126 500 2e-180 26..330 13..317
OsPrx121 498 1e-179 22..330 21..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 49980954..49981184 231 N° 2 49981442..49982203 762  
join(49980954..49981184,49981442..49982203)


exon

Literature and cross-references SbPrx11 (Sobic.001G293200.1[2.1]Sb01g028640[1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_1 (49980993..49982203)
Cluster/Prediction ref. PlantGDB:   SbGSStuc11-12-04.11749.1
Protein sequence: SbPrx11 (Sobic.001G293200.1[2.1]Sb01g028640[1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330
PWM (Da):   %s   35028.96 Transmb domain:   %s   i7-29o
PI (pH):   %s   9.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASPSARISAAALMAMLAVLALAAGGSAQLQYGFYKGKCNASDVEAVIQGIVKVRFARENPIVAYLLRMQFHECAVNGCDGGLLIDGPGTEKTAAPNLSVKGYDLIGAIKTALEGRCPGVVSCSDIQILATRDAVALAGGPAYAVRTGRRDRRQSRASDVRLPAPDYTAAQAVAYYARLGMNAFETVALLGAHTVGATRCSAIKNSRLYRYGGKPGATDPGMDPATASVYKKWVCPNVSSSDGNAVFLDDQWSALKVDNHYYKNLQQKRGVLSVDQNLYSDGSTRWIVDQLASNAALFQSQFAKVLVKLGEVNVLTGVQGEIRKVCSRFN*

Retrieve as FASTA  
Remarks Complete sequence from Genomic DNA (chrom 1, intron 1) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTCCATCAGCGCGCATCAGTGCGGCGGCGCTAATGGCGATGCTGGCGGTGCTGGCGCTCGCCGCTGGTGGCAGCGCACAGCTGCAGTACGGGTTCTACAAAGGCAAGTGCAAC
GCCAGCGACGTGGAGGCGGTGATCCAGGGCATCGTGAAGGTCCGCTTTGCGCGCGAGAACCCCATCGTCGCCTACCTCCTCCGGATGCAGTTCCACGAGTGCGCCGTCAAT
GTACGTATA
TAAATTAGGTCATGTCTGCTTCGGTTACGTTAAACTTTAACTTCCATTCCATCGAATGTTTAAACATATATATAGAGGAAAGACATAGCTAGATAATAATTTGTAAGACGAATTTTTTAA
ATCTAAATAGTACATAATTAGACATTAATTATTAAATGAAATAAAAATACTACAATAACTATTAAACTTGAAGACCAAACGGACCTGATAAGGAGTACGTGTACTTACGGTGGTTATTAC
GATTGCAGGGGTGCGACGGTGGTCTGCTGATCGACGGGCCCGGCACGGAGAAGACGGCGGCACCGAACCTGAGCGTCAAAGGCTACGACCTCATCGGAGCCATCAAAACGGCGCTGGAGG
GGAGGTGCCCCGGCGTGGTGTCCTGCTCCGACATCCAGATCCTCGCCACCAGGGACGCGGTGGCGCTGGCCGGCGGGCCGGCGTACGCGGTGCGCACGGGGCGCAGGGACCGCCGGCAGT
CTCGAGCCTCCGACGTGAGGCTCCCGGCGCCCGACTACACGGCGGCGCAGGCGGTCGCCTACTACGCCAGGCTTGGGATGAACGCGTTCGAGACGGTGGCGCTGCTGGGCGCGCACACCG
TGGGCGCCACGCGCTGCAGCGCCATCAAGAACAGCAGGCTGTACAGGTACGGCGGCAAGCCCGGCGCCACCGACCCAGGCATGGACCCGGCCACCGCGTCCGTATACAAGAAGTGGGTGT
GTCCGAACGTGTCCTCGTCGGACGGCAACGCCGTCTTCCTGGACGACCAGTGGAGCGCGCTCAAGGTGGACAACCACTACTACAAGAACCTGCAGCAGAAACGTGGAGTGCTCTCCGTCG
ATCAGAACCTGTACAGCGACGGCTCCACGCGATGGATCGTCGACCAGCTCGCCAGCAACGCTGCCCTCTTCCAGTCGCAGTTCGCCAAGGTTCTCGTTAAGCTCGGCGAGGTCAACGTGC
TGACAGGCGTGCAGGGAGAGATTCGAAAGGTCTGCAGCAGGTTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCTCCATCAGCGCGCATCAGTGCGGCGGCGCTAATGGCGATGCTGGCGGTGCTGGCGCTCGCCGCTGGTGGCAGCGCACAGCTGCAGTACGGGTTCTACAAAGGCAAGTGCAAC
GCCAGCGACGTGGAGGCGGTGATCCAGGGCATCGTGAAGGTCCGCTTTGCGCGCGAGAACCCCATCGTCGCCTACCTCCTCCGGATGCAGTTCCACGAGTGCGCCGTCAAT
GGGTGCGAC
GGTGGTCTGCTGATCGACGGGCCCGGCACGGAGAAGACGGCGGCACCGAACCTGAGCGTCAAAGGCTACGACCTCATCGGAGCCATCAAAACGGCGCTGGAGGGGAGGTGCCCCGGCGTG
GTGTCCTGCTCCGACATCCAGATCCTCGCCACCAGGGACGCGGTGGCGCTGGCCGGCGGGCCGGCGTACGCGGTGCGCACGGGGCGCAGGGACCGCCGGCAGTCTCGAGCCTCCGACGTG
AGGCTCCCGGCGCCCGACTACACGGCGGCGCAGGCGGTCGCCTACTACGCCAGGCTTGGGATGAACGCGTTCGAGACGGTGGCGCTGCTGGGCGCGCACACCGTGGGCGCCACGCGCTGC
AGCGCCATCAAGAACAGCAGGCTGTACAGGTACGGCGGCAAGCCCGGCGCCACCGACCCAGGCATGGACCCGGCCACCGCGTCCGTATACAAGAAGTGGGTGTGTCCGAACGTGTCCTCG
TCGGACGGCAACGCCGTCTTCCTGGACGACCAGTGGAGCGCGCTCAAGGTGGACAACCACTACTACAAGAACCTGCAGCAGAAACGTGGAGTGCTCTCCGTCGATCAGAACCTGTACAGC
GACGGCTCCACGCGATGGATCGTCGACCAGCTCGCCAGCAACGCTGCCCTCTTCCAGTCGCAGTTCGCCAAGGTTCTCGTTAAGCTCGGCGAGGTCAACGTGCTGACAGGCGTGCAGGGA
GAGATTCGAAAGGTCTGCAGCAGGTTCAACTGA

Retrieve as FASTA