Entry information : PoVP06_PC15 (MnP-short)
Entry ID 9686
Creation 2011-11-01 (Christophe Dunand)
Last sequence changes 2012-04-10 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-02-22 (Christophe Dunand)
Peroxidase information: PoVP06_PC15 (MnP-short)
Name (synonym) PoVP06_PC15 (MnP-short)
Class Versatile peroxidase    [Orthogroup: VP001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Pleurotaceae Pleurotus
Organism Pleurotus ostreatus (Oyster mushroom)    [TaxId: 5322 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value PoVP06_PC15
start..stop
S start..stop
PoVP06_PC9 721 0 1..357 1..357
PoVP06_IS-1 688 0 1..344 1..345
PoVP04_PC15 561 0 1..357 1..357
PsaVP01 543 0 1..357 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1981957..1982204 248 N° 2 1982261..1982395 135 N° 3 1982448..1982569 122 N° 4 1982621..1982696 76
N° 5 1982757..1982882 126 N° 6 1982934..1983003 70 N° 7 1983058..1983067 10 N° 8 1983118..1983153 36
N° 9 1983209..1983381 173 N° 10 1983436..1983500 65 N° 11 1983548..1983560 13  
join(1981957..1982204,1982261..1982395,1982448..1982569,1982621..1982696,1982757 ..1982882,1982934..1983003,1983058..1983067,1983118..1983153,1983209..1983381,19 83436..1983500,1983548..1983560)


exon

Literature and cross-references PoVP06_PC15 (MnP-short)
DNA ref. JGI genome:   scaffold_05 (1981957..1983560)
Protein sequence: PoVP06_PC15 (MnP-short)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   357 (336)
PWM (Da):   %s   37246.45 (35012.2)  
PI (pH):   %s   4.37 (4.28) Peptide Signal:   %s   cut: 22 range:22-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKNFSSLVLLTLASQAVRGAVMKRATCADGRTTANAACCVLFPILDDIQEALFDGAECGEEVHESLRLTFHDAIGFSPTKGGGGADGSIVTFDEIETAFHANGGIDDIVDAQKPFIARHNISAGDFIQFAGAVGVSNCPGAPRLNFLLGRPPATAASPNGLIPEPDTVTDILARMGDAGFSPEEVVALLASHSVAAADHVDETIPGTPFDSTPGEFDSQFFIETQLRGTAFPGVGGNQGEVESPLAGEIRIQSDHLARDSRTACEWQSFVNNQAKLQSAFKAAMDKLATLGQDRSKLIDCSDVIPVPKPLQSKAHLPAGLTMNNIEQCASTPFPALTADPGPVTSVPPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAACTTCTCGTCCCTTGTCCTCCTGACTTTGGCATCTCAAGCCGTCCGAGGCGCTGTCATGAAGCGTGCTACTTGCGCTGACGGACGTACTACTGCGAACGCCGCCTGC
TGCGTCCTATTCCCCATTCTGGATGACATCCAAGAGGCCCTCTTTGATGGTGCCGAGTGTGGTGAAGAGGTTCACGAGTCCCTTCGACTCACTTTCCATGACGCTATTGGTTTCTCGCCA
ACCAAAGG
GTATGTGCAAACCTTCGCATCTTCATGAATGGTGACTGACAACAAACACTCAATAGTGGAGGAGGTGCCGACGGCTCCATCGTAACTTTCGACGAAATCGAAACCGCTTTCC
ACGCCAACGGTGGAATCGACGACATTGTCGATGCGCAGAAGCCATTTATTGCTCGCCACAACATCTCCGCCGGTGACTT
GTAAGTTCCTTTGGGAAAAGTCGCAGTGAACCCATCTAACG
AGTTATTGTAGCATTCAATTTGCTGGCGCTGTTGGTGTCAGTAACTGCCCAGGAGCTCCAAGACTCAACTTCTTGCTTGGTCGCCCGCCAGCTACAGCAGCTTCGCCCAATGGTTTGATC
CCTGAACCATTCG
GTACGTTTACTTCTTTGGTACTATCAGTCATGCTTTAATAGTGTACATCAGACACCGTCACCGATATCCTTGCCCGTATGGGTGACGCTGGCTTCAGCCCGGAAGAG
GTCGTTGCCCTTCTGGCCTC
GTAAGTCAAACAGTAACCTATCTACCTATCTTGAAAATTGATGTGCTTCGATAATCCCAGACACTCCGTTGCTGCCGCAGACCACGTCGATGAGACCATT
CCAGGAACACCGTTCGACTCCACTCCAGGAGAATTTGACTCTCAATTCTTCATCGAAACCCAACTCCGTGGCACTGCTTTCCCAGG
GTAAGCGATCCATTACGTCGATCGTAGTCGCCAA
TCTCACTTCTTGAACAGTGTTGGCGGTAACCAAGGAGAGGTCGAATCGCCTCTTGCTGGAGAAATCCGTATCCAATCAGATCACGATGTACGTCTTTTCCACCTAAACTCGCTTTATTGT
TCTGATCAACTGTCTTTCTAGCTTGCTCGTGGTATGTATTCAGCTTGACGGTATACTACTTGATCTTAAAGGTTTGATTAGATTCTCGCACTGCTTGCGAGTGGCAATCCTTCGTTAGTG
AGTACAAGCAACACCATTTTCATGCCTCATCGCGATACTGAACATCCTCTAGACAACCAGGCCAAGCTTCAATCCGCTTTCAAGGCTGCTATGGACAAGTTGGCTACACTCGGTCAAGAT
CGCTCAAAGCTCATTGACTGCTCTGATGTTATCCCTGTCCCCAAGCCATTGCAGAGCAAGGCCCATCTCCCTGCTGGCCTGACGATGAACAACATCGAGCAAGCG
GTACGTGGAGAGTTC
GATTCACTGATTTGCTTTCTCACTCAATGGCTTCTTTAGTGTGCTTCTACCCCCTTCCCAGCTCTCACTGCCGACCCTGGCCCAGTCACTTCTGTCCCCCCTGTGTAAGTCTCAAGTTCT
CCTGTTGACACGTAACTCAACAGTTGTTCAGTCCCCCTTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAACTTCTCGTCCCTTGTCCTCCTGACTTTGGCATCTCAAGCCGTCCGAGGCGCTGTCATGAAGCGTGCTACTTGCGCTGACGGACGTACTACTGCGAACGCCGCCTGC
TGCGTCCTATTCCCCATTCTGGATGACATCCAAGAGGCCCTCTTTGATGGTGCCGAGTGTGGTGAAGAGGTTCACGAGTCCCTTCGACTCACTTTCCATGACGCTATTGGTTTCTCGCCA
ACCAAAGG
TGGAGGAGGTGCCGACGGCTCCATCGTAACTTTCGACGAAATCGAAACCGCTTTCCACGCCAACGGTGGAATCGACGACATTGTCGATGCGCAGAAGCCATTTATTGCTCGC
CACAACATCTCCGCCGGTGACTT
CATTCAATTTGCTGGCGCTGTTGGTGTCAGTAACTGCCCAGGAGCTCCAAGACTCAACTTCTTGCTTGGTCGCCCGCCAGCTACAGCAGCTTCGCCC
AATGGTTTGATCCCTGAACCATTCG
ACACCGTCACCGATATCCTTGCCCGTATGGGTGACGCTGGCTTCAGCCCGGAAGAGGTCGTTGCCCTTCTGGCCTCACACTCCGTTGCTGCCGCA
GACCACGTCGATGAGACCATTCCAGGAACACCGTTCGACTCCACTCCAGGAGAATTTGACTCTCAATTCTTCATCGAAACCCAACTCCGTGGCACTGCTTTCCCAGG
TGTTGGCGGTAAC
CAAGGAGAGGTCGAATCGCCTCTTGCTGGAGAAATCCGTATCCAATCAGATCACGAT
CTTGCTCGTGATTCTCGCACTGCTTGCGAGTGGCAATCCTTCGTTAACAACCAGGCCAAGCTT
CAATCCGCTTTCAAGGCTGCTATGGACAAGTTGGCTACACTCGGTCAAGATCGCTCAAAGCTCATTGACTGCTCTGATGTTATCCCTGTCCCCAAGCCATTGCAGAGCAAGGCCCATCTC
CCTGCTGGCCTGACGATGAACAACATCGAGCAAGCG
TGTGCTTCTACCCCCTTCCCAGCTCTCACTGCCGACCCTGGCCCAGTCACTTCTGTCCCCCCTGTTCCCCCTTCGTAA

Retrieve as FASTA  
cDNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TTTTAGTGTT GCCGCCGCTG TGAGAACAAC GGATGACTCT ACCATCAAAT CGGGAGCTCT GTTCTACCAG TTCCGAATGC CCGGTACAGG CGTGGACGCT CTCGACAGAG CTCGATCGTA  GATCTTCTTC CAACAACTTC TCATGGCAGC TCCAAGGACT CATGGCGAAC CTCTACTGAT TGACGCGAGG CGCATAGTCA AAATTTCTCG ATGAGAACTA TACGGAAGTA AGTATGTTTT  CGCGTTGCGA TGCACAACTC ACGCGTCGTG ATTGGCCATT CCAGCTGATA CGGCATTCGG TGACCTTCAC GAATAGTGGC CTCTCTACGG GTAGAAATGG TATAAAAGGG TGCCGACATA  GCAGTGTTTG AAGCAGAGAA CCTCGTCTCT TCAACTCCAG CAATGGCCTT CAAGAACTTC TCGTCCCTTG TCCTCCTGAC TTTGGCATCT CAAGCCGTCC GAGGCGCTGT CATGAAGCGT  GCTACTTGCG CTGACGGACG TACTACTGCG AACGCCGCCT GCTGCGTCCT ATTCCCCATT CTGGATGACA TCCAAGAGGC CCTCTTTGAT GGTGCCGAGT GTGGTGAAGA GGTTCACGAG  TCCCTTCGAC TCACTTTCCA TGACGCTATT GGTTTCTCGC CAACCAAAGG TGGAGGAGGT GCCGACGGCT CCATCGTAAC TTTCGACGAA ATCGAAACCG CTTTCCACGC CAACGGTGGA  ATCGACGACA TTGTCGATGC GCAGAAGCCA TTTATTGCTC GCCACAACAT CTCCGCCGGT GACTTCATTC AATTTGCTGG CGCTGTTGGT GTCAGTAACT GCCCAGGAGC TCCAAGACTC  AACTTCTTGC TTGGTCGCCC GCCAGCTACA GCAGCTTCGC CCAATGGTTT GATCCCTGAA CCATTCGACA CCGTCACCGA TATCCTTGCC CGTATGGGTG ACGCTGGCTT CAGCCCGGAA  GAGGTCGTTG CCCTTCTGGC CTCACACTCC GTTGCTGCCG CAGACCACGT CGATGAGACC ATTCCAGGAA CACCGTTCGA CTCCACTCCA GGAGAATTTG ACTCTCAATT CTTCATCGAA  ACCCAACTCC GTGGCACTGC TTTCCCAGGT GTTGGCGGTA ACCAAGGAGA GGTCGAATCG CCTCTTGCTG GAGAAATCCG TATCCAATCA GATCACGATC TTGCTCGAGA TTCTCGCACT  GCTTGCGAGT GGCAATCCTT CGTTAACAAC CAGGCCAAGC TTCAATCCGC TTTCAAGGCT GCTATGGACA AGTTGGCTAC ACTCGGTCAA GATCGCTCAA AGCTCATTGA CTGCTCTGAT  GTTATCCCTG TCCCCAAGCC ATTGCAGAGC AAGGCCCATC TCCCTGCTGG CCTGACGATG AACAACATCG AGCAAGCGTG TGCTTCTACC CCCTTCCCAG CTCTCACTGC CGACCCTGGC  CCAGTCACTT CTGTCCCCCC TGTTCCCCCT TCGTAAACCG TGATGACCAG AAAATTGATC AAGCGCCACT TTCCTTTTCA TCAGCGGGTA GCATAATCGT GTCGGGTTTT GTTTAAGTAA 
TATACCTCTT AGAATCAACT TTCCTTTGGA TCGT 

Retrieve as FASTA