Entry information : GsppCIIBA09
Entry ID 9689
Creation 2011-11-15 (Christophe Dunand)
Last sequence changes 2012-03-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-26 (Christophe Dunand)
Peroxidase information: GsppCIIBA09
Name GsppCIIBA09
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Ganoderma sp. 10597 SS1    [TaxId: 767862 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GsppCIIBA09
start..stop
S start..stop
GsppCIIBA08 726 0 1..361 1..361
ParcCIIBA06 607 0 1..361 1..361
DsCIIBA04 581 0 1..361 1..361
GsppCIIBA04 579 0 1..361 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 131950..132057 108 N° 2 131852..131895 44 N° 3 131755..131800 46 N° 4 131643..131701 59
N° 5 131528..131583 56 N° 6 131400..131478 79 N° 7 130899..131338 440 N° 8 130652..130827 176
N° 9 130516..130580 65 N° 10 130437..130449 13  
complement(join(130437..130449,130516..130580,130652..130827,130899..131338,131 400..131478,131528..131583,131643..131701,131755..131800,131852..131895,131950.. 132057))


exon

Literature and cross-references GsppCIIBA09
DNA ref. JGI genome:   scaffold_1 (132057..130437)
Protein sequence: GsppCIIBA09
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (343)
PWM (Da):   %s   37710.78 (35939.8)  
PI (pH):   %s   4.6 (4.53) Peptide Signal:   %s   cut: 19 range:19-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSKAILSLAALAVAVNAVPAPSAVCSQGRRASSEACCVWFDVLDDLQANLFDGGECGEEAHESLLTFHDAIGFSPALFREGKFGGGGADGSIMAFAQIETNHANIGVDEIVEVQRPFAIKHGVSFGDFIQFAGAVAVSNCAGGPRLQFLAGRSNISQPSPDLLVPEPSDSNDKIFARMGDAGFSPVEVVDLLASHTVAAQDHVDPTIPGTPFDSTPSSFDAQFFVETLLKGTLFPGNGSNVGELQSPLGGEFRLFSDGNIARDARTACEWQSFSDHASMVRKFEAVMAKLAVTGHNPRALTDCSEVIPVPANVQLPPVTLPAGKSLRDVEACRATPFPAIRAAPGPATTVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (8 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCCAAGGCCATCCTCTCTCTTGCTGCGCTCGCGGTCGCTGTCAACGCCGTCCCCGCCCCGTCGGCCGTTTGCAGCCAGGGCCGCCGTGCCAGCAGCGAGGCGGTCAGTGCTTTC
TTCTTCACCCACTACGTCAGCCTACTCATCCTATGATTACAGTGCTGCGTCTGGTTCGATGTCCTCGACGACCTCCAGGCGAACCTGTGAGGACCATTTGTCCTCTATGAGCATACACTT
GTGCTGATGCCTTGCAGGTTCGACGGCGGCGAGTGCGGTGAGGAGGCTCACGAGTCTCTCCGCGTTAGTGGCAATGTCGCATTCAACTAAGGCCTAGCTGACGGTTCATTCTACAGTTGA
CCTTCCACGACGCCATCGGCTTCTCCCCCGCTCTCTTCCGTGAGGGCAAGTTCGG
GTACGGAGCCGTCCCTGCTTCTTGATCCTCCCAAATGTTGGCTGATCGAAAGTTTGCAGTGGCGG
AGGTGCCGACGGCTCCATTATGGCCTTCGCCCAGATCGAAACCAACTTCC
GTCAGTGTCCTTAGCTCTCCACCGGCTCTCAAAATTGACCGCCTGACAGACGCAAACATCGGTGTTGACG
AGATCGTCGAGGTCCAGCGCCCCTTCGCGATTAAGCACGGCGTGTCCTTCGGCGACTT
GTACGTCCCCCCCCCCCTCCACTCACCATCCTCCTCTCACACACGCGCCCAATCCACACAGC
ATCCAGTTCGCCGGCGCGGTCGCCGTCTCGAACTGCGCAGGCGGCCCGCGCCTGCAGTTCCTCGCCGGCCGCTCGAACATCTCGCAGCCCTCGCCGGACCTGCTCGTGCCCGAGCCGTCC
GACTCCAACGACAAGATCTTCGCGCGCATGGGCGACGCGGGCTTCTCGCCCGTCGAGGTCGTCGACCTCCTCGCGTCGCACACCGTCGCCGCGCAGGACCACGTCGACCCGACGATCCCG
GGCACGCCGTTCGACTCGACGCCGAGCTCGTTCGACGCGCAGTTCTTCGTCGAGACGCTTCTCAAGGGCACGCTCTTCCCGGGCAACGGCTCGAACGTCGGCGAGCTCCAGTCGCCACTC
GGCGGCGAGTTCCGCCTGTTCTCGGACGGGAACATCGCGCGCGACGCGCGCACGGCGTGCGAGTGGCAGTCCTTCATCT
GTGCGTCGCTCTCTTCTCCCTCTTCCCTTCCCGCCCTGGAA
TATTGCTGACCCCGTGATCGCGCGATGCAGCTGACCACGCGTCGATGGTGCGCAAGTTCGAGGCGGTGATGGCCAAGCTCGCGGTGACCGGCCACAACCCCCGCGCGCTCACCGACTGCT
CCGAGGTCATCCCCGTCCCCGCCAACGTCCAGCTCCCCCCGGTCACCCTCCCCGCCGGGAAGTCGCTCCGCGACGTTGAGGCTGCT
GTGCGTCCTCTTCTTTTCCTTCGTCTGGCTTGCT
GAGGTTTGGACTTTGCTGACGAGCATGTGCGATGCAGTGCCGCGCGACCCCCTTCCCCGCGATCCGCGCGGCCCCCGGCCCAGCGACTACCGTCGCGCCCGTGTACGTCCCTTCTCCTTG
GCTGTTGCGTGGGTTACATCAATGGGTGCTGACGATGGTCTTTCCCAGCCCCCCCTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCCAAGGCCATCCTCTCTCTTGCTGCGCTCGCGGTCGCTGTCAACGCCGTCCCCGCCCCGTCGGCCGTTTGCAGCCAGGGCCGCCGTGCCAGCAGCGAGGCGTGCTGCGTCTGG
TTCGATGTCCTCGACGACCTCCAGGCGAACCT
GTTCGACGGCGGCGAGTGCGGTGAGGAGGCTCACGAGTCTCTCCGCTTGACCTTCCACGACGCCATCGGCTTCTCCCCCGCTCTCTTC
CGTGAGGGCAAGTTCGG
TGGCGGAGGTGCCGACGGCTCCATTATGGCCTTCGCCCAGATCGAAACCAACTTCCACGCAAACATCGGTGTTGACGAGATCGTCGAGGTCCAGCGCCCCTTC
GCGATTAAGCACGGCGTGTCCTTCGGCGACTT
CATCCAGTTCGCCGGCGCGGTCGCCGTCTCGAACTGCGCAGGCGGCCCGCGCCTGCAGTTCCTCGCCGGCCGCTCGAACATCTCGCAG
CCCTCGCCGGACCTGCTCGTGCCCGAGCCGTCCGACTCCAACGACAAGATCTTCGCGCGCATGGGCGACGCGGGCTTCTCGCCCGTCGAGGTCGTCGACCTCCTCGCGTCGCACACCGTC
GCCGCGCAGGACCACGTCGACCCGACGATCCCGGGCACGCCGTTCGACTCGACGCCGAGCTCGTTCGACGCGCAGTTCTTCGTCGAGACGCTTCTCAAGGGCACGCTCTTCCCGGGCAAC
GGCTCGAACGTCGGCGAGCTCCAGTCGCCACTCGGCGGCGAGTTCCGCCTGTTCTCGGACGGGAACATCGCGCGCGACGCGCGCACGGCGTGCGAGTGGCAGTCCTTCATCT
CTGACCAC
GCGTCGATGGTGCGCAAGTTCGAGGCGGTGATGGCCAAGCTCGCGGTGACCGGCCACAACCCCCGCGCGCTCACCGACTGCTCCGAGGTCATCCCCGTCCCCGCCAACGTCCAGCTCCCC
CCGGTCACCCTCCCCGCCGGGAAGTCGCTCCGCGACGTTGAGGCTGCT
TGCCGCGCGACCCCCTTCCCCGCGATCCGCGCGGCCCCCGGCCCAGCGACTACCGTCGCGCCCGTCCCCCCC
TCCTAA

Retrieve as FASTA