Entry information : GsppCIIBB03
Entry ID 9690
Creation 2011-11-15 (Christophe Dunand)
Last sequence changes 2011-11-15 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-29 (Nizar Fawal)
Peroxidase information: GsppCIIBB03
Name GsppCIIBB03
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Ganoderma sp. 10597 SS1    [TaxId: 767862 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GsppCIIBB03
start..stop
S start..stop
DsCIIBB08 622 0 1..362 1..366
ParcCIIBB08 608 0 1..359 1..361
ParcCIIBB11 609 0 1..362 3..364
ParcCIIBB02 607 0 1..362 1..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1446341..1446395 55 N° 2 1446062..1446266 205 N° 3 1445197..1446012 816 N° 4 1445122..1445134 13
complement(join(1445122..1445134,1445197..1446012,1446062..1446266,1446341..1446 395))


exon

Literature and cross-references GsppCIIBB03
DNA ref. JGI genome:   scaffold_3 (1446395..1445122)
Protein sequence: GsppCIIBB03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (343)
PWM (Da):   %s   37597.67 (35727.6)  
PI (pH):   %s   4.13 (4.13) Peptide Signal:   %s   cut: 20 range:20-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFTALLVSVLAALQVANGALIRRATCSDGTVVADGACCALIPIIQDLQANLFDGGECGEDVHESLRLTFHDAIGISPAIAARGQFGGGGADGSIALFESIETNFHANLGVDEIIDTQRPFIQRHNITTADFIQLAGAIGVSNCPGAPQLNVFIGRADATQPAPDLTVPEPFDTVDSILARFSDAGGFTPAEVVALLASHTVAAADHVDPSIPGTPFDSTPSLFDTQFFIETQLRGTLFPGTGGNQGEVESPLHGEIRLQSDSELARDSRTACEWQSFVNNQAKIQSAFKAAFRKMTVLGHDETQLLDCSDVVPVPPAPASPAHFPAGLSNADVEQACADTPFPTLPTDPGAVTSVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCACAGCCCTCCTCGTCTCTGTTCTCGCTGCTCTCCAGGTCGCGAACGGTGCGTTGCCCGTTTTCCATGCCAAAACACCTTCGCACCGAAGCGACTGACTTATTTTTCTCTCC
TTCCAATAGGCGCTCTCATCCGCCGTGCGACCTGCTCTGACGGTACCGTCGTCGCCGACGGCGCCTGCTGTGCCCTCATCCCGATCATCCAGGATCTCCAGGCCAACCTGTTCGACGGCG
GCGAGTGCGGCGAGGACGTTCACGAGTCCCTTCGCCTCACTTTCCACGATGCCATTGGTATCTCGCCCGCCATCGCCGCCCGTGGCCAATTCGG
GTCCGTAACTTTTGCACTCACCCTGT
GGATCATACTAACGAACGTACAGAGGTGGAGGCGCTGACGGTTCCATTGCGCTCTTCGAGTCCATCGAGACGAACTTCCACGCCAACCTTGGTGTCGACGAGATCATCGACACGCAGAGG
CCGTTCATCCAGCGCCACAACATCACCACCGCCGACTTCATCCAGCTCGCTGGTGCGATCGGTGTATCGAACTGCCCCGGCGCTCCTCAGCTCAACGTCTTCATCGGCCGTGCGGACGCC
ACTCAGCCCGCCCCCGACTTGACCGTCCCGGAGCCGTTCGACACCGTCGACAGCATCCTCGCTCGGTTCTCCGACGCCGGAGGCTTCACCCCTGCTGAGGTTGTTGCCCTCCTCGCCTCG
CACACCGTTGCGGCGGCCGACCACGTCGACCCCTCCATCCCCGGAACGCCCTTCGACTCGACGCCCTCGCTCTTCGACACACAGTTCTTCATCGAGACTCAGCTCCGCGGTACGCTCTTC
CCCGGCACGGGGGGCAACCAGGGCGAGGTCGAGTCCCCGCTCCACGGCGAGATCCGCCTCCAGTCTGACTCCGAGCTCGCGCGCGACTCGCGCACGGCGTGCGAGTGGCAGTCGTTCGTG
AACAACCAGGCCAAGATCCAGTCCGCGTTCAAGGCCGCGTTCCGCAAGATGACCGTCCTCGGCCACGACGAGACCCAGCTCCTCGACTGCTCCGACGTCGTCCCCGTCCCGCCCGCCCCC
GCGAGTCCCGCGCACTTCCCCGCCGGGCTCTCCAACGCCGATGTCGAGCAGGCGTGTGCCGACACCCCCTTCCCCACTCTCCCCACCGACCCCGGCGCGGTCACCTCCGTCGCCCCCGT
G
TAAGTAGCTCGTTCTCAAGGGGTCCGATCAACGAGATACTGACATGTCATATGATTCACAGCCCTCCTTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCACAGCCCTCCTCGTCTCTGTTCTCGCTGCTCTCCAGGTCGCGAACGGCGCTCTCATCCGCCGTGCGACCTGCTCTGACGGTACCGTCGTCGCCGACGGCGCCTGCTGTGCC
CTCATCCCGATCATCCAGGATCTCCAGGCCAACCTGTTCGACGGCGGCGAGTGCGGCGAGGACGTTCACGAGTCCCTTCGCCTCACTTTCCACGATGCCATTGGTATCTCGCCCGCCATC
GCCGCCCGTGGCCAATTCGG
AGGTGGAGGCGCTGACGGTTCCATTGCGCTCTTCGAGTCCATCGAGACGAACTTCCACGCCAACCTTGGTGTCGACGAGATCATCGACACGCAGAGGCCG
TTCATCCAGCGCCACAACATCACCACCGCCGACTTCATCCAGCTCGCTGGTGCGATCGGTGTATCGAACTGCCCCGGCGCTCCTCAGCTCAACGTCTTCATCGGCCGTGCGGACGCCACT
CAGCCCGCCCCCGACTTGACCGTCCCGGAGCCGTTCGACACCGTCGACAGCATCCTCGCTCGGTTCTCCGACGCCGGAGGCTTCACCCCTGCTGAGGTTGTTGCCCTCCTCGCCTCGCAC
ACCGTTGCGGCGGCCGACCACGTCGACCCCTCCATCCCCGGAACGCCCTTCGACTCGACGCCCTCGCTCTTCGACACACAGTTCTTCATCGAGACTCAGCTCCGCGGTACGCTCTTCCCC
GGCACGGGGGGCAACCAGGGCGAGGTCGAGTCCCCGCTCCACGGCGAGATCCGCCTCCAGTCTGACTCCGAGCTCGCGCGCGACTCGCGCACGGCGTGCGAGTGGCAGTCGTTCGTGAAC
AACCAGGCCAAGATCCAGTCCGCGTTCAAGGCCGCGTTCCGCAAGATGACCGTCCTCGGCCACGACGAGACCCAGCTCCTCGACTGCTCCGACGTCGTCCCCGTCCCGCCCGCCCCCGCG
AGTCCCGCGCACTTCCCCGCCGGGCTCTCCAACGCCGATGTCGAGCAGGCGTGTGCCGACACCCCCTTCCCCACTCTCCCCACCGACCCCGGCGCGGTCACCTCCGTCGCCCCCGT
CCCT
CCTTCCTAA

Retrieve as FASTA