Entry information : GsppCIIBA08
Entry ID 9695
Creation 2011-11-15 (Christophe Dunand)
Last sequence changes 2012-03-26 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-11-15 (Christophe Dunand)
Peroxidase information: GsppCIIBA08
Name GsppCIIBA08
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Fungi/Metazoa; Fungi; Basidiomycota; Basidiomycota
Organism Ganoderma sp. 10597 SS1    [TaxId: 767862 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value GsppCIIBA08
start..stop
S start..stop
GsppCIIBA09 726 0 1..361 1..361
ParcCIIBA06 607 0 1..361 1..361
DsCIIBA04 581 0 1..361 1..361
GsppCIIBA04 579 0 1..361 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 73847..73954 108 N° 2 74009..74052 44 N° 3 74104..74149 46 N° 4 74203..74261 59
N° 5 74321..74376 56 N° 6 74426..74504 79 N° 7 74569..75008 440 N° 8 75080..75255 176
N° 9 75329..75393 65 N° 10 75459..75471 13  
join(73847..73954,74009..74052,74104..74149,74203..74261,74321..74376,74426..745 04,74569..75008,75080..75255,75329..75393,75459..75471)


exon

Literature and cross-references GsppCIIBA08
DNA ref. JGI genome:   scaffold_1 (73847..75471)
Protein sequence: GsppCIIBA08
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   361 (343)
PWM (Da):   %s   37710.78 (35939.8)  
PI (pH):   %s   4.6 (4.53) Peptide Signal:   %s   cut: 19 range:19-361
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFSKAILSLAALAVAVNAVPAPSAVCSQGRRASSEACCVWFDVLDDLQANLFDGGECGEEAHESLLTFHDAIGFSPALFREGKFGGGGADGSIMAFAQIETNHANIGVDEIVEVQRPFAIKHGVSFGDFIQFAGAVAVSNCAGGPRLQFLAGRSNISQPSPDLLVPEPSDSNDKIFARMGDAGFSPVEVVDLLASHTVAAQDHVDPTIPGTPFDSTPSSFDAQFFVETLLKGTLFPGNGSNVGELQSPLGGEFRLFSDGNIARDARTACEWQSFSDHASMVRKFEAVMAKLAVTGHNPRALTDCSEVIPVPANVQLPPVTLPAGKSLRDVEACRATPFPAIRAAPGPATTVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (9 introns). Tandem duplication of perox ID#9689.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCCAAGGCCATCCTCTCTCTTGCTGCGCTCGCGGTCGCTGTCAACGCCGTCCCCGCCCCGTCGGCCGTTTGCAGCCAGGGCCGCCGTGCCAGCAGCGAGGCGGTCAGTGCTTTC
TTCTTCACCCACCACATCAGCCTACTCATCCTATGATTACAGTGCTGCGTCTGGTTCGATGTCCTCGACGACCTCCAGGCGAACCTGTGAGGACCATTTGTCCTCTATGAGCATACACTT
GTGCTGATGCCTTGCAGGTTCGACGGCGGCGAGTGCGGTGAGGAGGCTCACGAGTCTCTCCGCGTTAGTGGCAACGTCGCATTCAACCAAGGCCTAGCTAACGGTTCATTCTACAGTTGA
CCTTCCATGACGCCATTGGCTTCTCCCCCGCTCTCTTCCGCGAGGGCAAGTTCGG
GTACGGAGCCGTCCCTGCTTCTTCATCCTCACAAATGTTGGCTGATCGAAAGTTTGCAGTGGCGG
AGGTGCCGACGGCTCCATTATGGCCTTCGCCCAGATCGAAACCAACTTCC
GTCAGTGTCCTTAGCTCTCCACCGGCTCCCAAAACTGACCACTTGACAGACGCAAACATCGGTGTCGACG
AGATCGTCGAGGTCCAGCGCCCCTTCGCGATTAAGCACGGCGTGTCCTTCGGCGACTT
GTACGTCCCCTCCCCCACCCTCAACTCACCATCCTCCACTCACACACGCGCCCAATCCACAC
AGCATCCAGTTCGCCGGCGCGGTCGCCGTCTCGAACTGCGCAGGCGGCCCGCGCCTGCAGTTCCTCGCCGGCCGCTCGAACATCTCGCAGCCCTCGCCGGACCTGCTCGTGCCCGAGCCG
TCCGACTCCAACGACAAGATCTTCGCGCGCATGGGCGACGCGGGCTTCTCGCCCGTCGAGGTCGTCGACCTCCTCGCGTCGCACACCGTCGCCGCGCAGGACCACGTCGACCCGACGATC
CCGGGCACGCCGTTCGACTCGACGCCGAGCTCGTTCGACGCGCAGTTCTTCGTCGAGACGCTCCTCAAGGGTACGCTCTTCCCGGGCAACGGCTCGAACGTCGGCGAGCTCCAGTCGCCA
CTCGGCGGCGAGTTCCGCCTGTTCTCGGACGGGAACATCGCGCGCGACGCGCGCACCGCGTGCGAGTGGCAGTCCTTCATCT
GTGCGTCGCTCTCTTCTCCCTCTTCCCTTCCCGCCCTC
GACTATTGCTGACCCCGTTATCGCGCGATGCAGCCGACCACGCATCGATGGTGCGCAAGTTCGAGGCGGTGATGGCCAAGCTCGCGGTGACCGGCCACAACCCCCGCGCGCTCACCGACT
GCTCCGAGGTCATCCCCGTCCCCGCCAACGTCCAGCTCCCCCCGGTCACCCTCCCCGCCGGGAAGTCGCTCCGCGACGTCGAGGCTGCT
GTGCGTCTTCTTCTCTTCCTTCCTCCGGCTT
GCTGAGGTTTGGACTCTGCTGACGAGCATGTGTGCGATGCAGTGCCGCGCGACCCCCTTCCCCGCGATCCGCGCCGCCCCCGGCCCGGCGACTACCGTCGCGCCCGTGTACGTCCTTCTT
GTTGTTGTTGTGTGGATTACATCAATGGGTGCTGACGATGGTCTTTCCCCAGCCCCCCGTCCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCTCCAAGGCCATCCTCTCTCTTGCTGCGCTCGCGGTCGCTGTCAACGCCGTCCCCGCCCCGTCGGCCGTTTGCAGCCAGGGCCGCCGTGCCAGCAGCGAGGCGTGCTGCGTCTGG
TTCGATGTCCTCGACGACCTCCAGGCGAACCT
GTTCGACGGCGGCGAGTGCGGTGAGGAGGCTCACGAGTCTCTCCGCTTGACCTTCCATGACGCCATTGGCTTCTCCCCCGCTCTCTTC
CGCGAGGGCAAGTTCGG
TGGCGGAGGTGCCGACGGCTCCATTATGGCCTTCGCCCAGATCGAAACCAACTTCCACGCAAACATCGGTGTCGACGAGATCGTCGAGGTCCAGCGCCCCTTC
GCGATTAAGCACGGCGTGTCCTTCGGCGACTT
CATCCAGTTCGCCGGCGCGGTCGCCGTCTCGAACTGCGCAGGCGGCCCGCGCCTGCAGTTCCTCGCCGGCCGCTCGAACATCTCGCAG
CCCTCGCCGGACCTGCTCGTGCCCGAGCCGTCCGACTCCAACGACAAGATCTTCGCGCGCATGGGCGACGCGGGCTTCTCGCCCGTCGAGGTCGTCGACCTCCTCGCGTCGCACACCGTC
GCCGCGCAGGACCACGTCGACCCGACGATCCCGGGCACGCCGTTCGACTCGACGCCGAGCTCGTTCGACGCGCAGTTCTTCGTCGAGACGCTCCTCAAGGGTACGCTCTTCCCGGGCAAC
GGCTCGAACGTCGGCGAGCTCCAGTCGCCACTCGGCGGCGAGTTCCGCCTGTTCTCGGACGGGAACATCGCGCGCGACGCGCGCACCGCGTGCGAGTGGCAGTCCTTCATCT
CCGACCAC
GCATCGATGGTGCGCAAGTTCGAGGCGGTGATGGCCAAGCTCGCGGTGACCGGCCACAACCCCCGCGCGCTCACCGACTGCTCCGAGGTCATCCCCGTCCCCGCCAACGTCCAGCTCCCC
CCGGTCACCCTCCCCGCCGGGAAGTCGCTCCGCGACGTCGAGGCTGCT
TGCCGCGCGACCCCCTTCCCCGCGATCCGCGCCGCCCCCGGCCCGGCGACTACCGTCGCGCCCGTCCCCCCG
TCCTAA

Retrieve as FASTA