Entry information : LmaCIIAB03
Entry ID 9698
Creation 2011-10-27 (Christophe Dunand)
Last sequence changes 2012-11-06 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-11-06 (Christophe Dunand)
Peroxidase information: LmaCIIAB03
Name LmaCIIAB03
Class Asco Class II type B    [Orthogroup: CIIAB001]
Taxonomy Eukaryota Fungi Ascomycota Dothideomycetes Leptosphaeriaceae Leptosphaeria
Organism Leptosphaeria maculans    [TaxId: 5022 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value LmaCIIAB03
start..stop
S start..stop
Ssrc1lsm3aCIIAB06 358 3e-125 2..283 1..282
ClunCIIAB02 354 1e-123 2..294 1..295
AalteCIIAB01 353 2e-123 7..294 4..294
AbraCIIAB03 343 3e-119 1..293 1..293
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1292848..1293022 175 N° 2 1293118..1293617 500 N° 3 1293763..1293993 231  
join(1292848..1293022,1293118..1293617,1293763..1293993)


exon

Literature and cross-references LmaCIIAB03
Protein ref. UniProtKB:   E4ZK78 [Incorrect prediction]
DNA ref. JGI genome:   lm_SuperContig_7_v2 (1292848..1293999)
Protein sequence: LmaCIIAB03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   301 (283)
PWM (Da):   %s   32413.06 (30496.1)  
PI (pH):   %s   6.85 (6.65) Peptide Signal:   %s   cut: 19 range:19-301
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMHSHVLTVLILPLCASALHIWPRQSSNCPAVWKDIAERLKSDFAGCNPLSHAAIRAPFHDCINNGCDGSLILTSECTRSENAGLPQLCTHLLSLTNEFSVSAADTVQFAAAIAISSCPLGPRVRALVGRRSSDSAAAEGQIPGSRDAVEDILGAFRAKGISAGELVALLGTHSVAQQRFDDPSQAGQPLDSTPWVYDSVFYKETRSGQAPYSLSSDRRLSNYSTSEAWSTFADSISSWAAVFVPAWNKFSVIGNDVGSLQDCSYLVPQGQVSRKRAYVNAMFREKMAARFKLRESGETD*

Retrieve as FASTA  
Remarks Complete sequence from genomic (2 introns). incorrect prediction from JGI (extra intron in 3').
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCACAGTCATGTGCTCACAGTCCTTATTCTTCCGCTATGTGCTTCTGCACTCCACATCTGGCCCCGTCAGTCTAGCAACTGTCCAGCAGTATGGAAAGACATTGCCGAACGCCTC
AAATCTGACTTTGCGGGCTGCAACCCACTATCCCATGCCGCCATACGCGCCCCAT
GTACGTAAAAACATAGTAGACATCATCTCAAAGGCCCCCAAAACCCACACCCTCCAATATCGTCC
CCACTGACCAACCGCCTACCCAAACAAAAGTTCACGACTGCATTAACAATGGCTGTGACGGCTCCCTCATCCTCACTTCCGAATGCACACGCTCCGAAAACGCCGGCCTCCCCCAACTCT
GCACCCACCTCTTAAGCCTCACGAATGAATTCTCCGTCTCGGCCGCAGACACCGTCCAGTTTGCCGCCGCAATCGCCATATCCTCATGCCCGCTTGGACCGCGCGTCCGCGCCCTCGTAG
GTCGTCGCTCCAGCGATTCTGCCGCGGCCGAGGGCCAGATACCCGGGAGCCGGGATGCGGTTGAAGATATACTGGGGGCGTTTAGGGCAAAAGGGATAAGTGCTGGGGAGCTGGTCGCTT
TGCTGGGGACACACTCTGTGGCACAGCAGCGTTTTGATGATCCGAGTCAGGCGGGGCAACCGCTGGATAGTACGCCATGGGTTTATGACAGTGTTTTCTATAAGGAGACGAGGAGTGGTC
AGGCGCCCTATTCGCTGAGTAGTGACAGGAGGCTGAGTAATTACAGTGAG
GTGAGTTCGCGAGAGCTTCTCGACTACTTTGTTTGGGAATTAGCGGAGGGCGTGTAATCTTGGCAAGGTG
GAAGAGGGATCGCTAGGGAATCCATGATATTCGACTTGCATGGGACTGAAGCTGTGCTAACTCTTGCAATGATAGACGTCAGAGGCTTGGTCCACATTCGCTGATAGTATCTCATCCTGG
GCTGCTGTCTTCGTCCCCGCGTGGAATAAATTCAGTGTTATTGGTAACGATGTGGGGAGTTTGCAGGACTGTTCCTATCTGGTACCGCAGGGTCAGGTGAGTCGAAAGAGAGCTTATGTA
AATGCGATGTTTCGGGAGAAGATGGCTGCGAGGTTCAAACTTCGAGAAAGCGGCGAAACAGATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGCACAGTCATGTGCTCACAGTCCTTATTCTTCCGCTATGTGCTTCTGCACTCCACATCTGGCCCCGTCAGTCTAGCAACTGTCCAGCAGTATGGAAAGACATTGCCGAACGCCTC
AAATCTGACTTTGCGGGCTGCAACCCACTATCCCATGCCGCCATACGCGCCCCAT
TTCACGACTGCATTAACAATGGCTGTGACGGCTCCCTCATCCTCACTTCCGAATGCACACGCTCC
GAAAACGCCGGCCTCCCCCAACTCTGCACCCACCTCTTAAGCCTCACGAATGAATTCTCCGTCTCGGCCGCAGACACCGTCCAGTTTGCCGCCGCAATCGCCATATCCTCATGCCCGCTT
GGACCGCGCGTCCGCGCCCTCGTAGGTCGTCGCTCCAGCGATTCTGCCGCGGCCGAGGGCCAGATACCCGGGAGCCGGGATGCGGTTGAAGATATACTGGGGGCGTTTAGGGCAAAAGGG
ATAAGTGCTGGGGAGCTGGTCGCTTTGCTGGGGACACACTCTGTGGCACAGCAGCGTTTTGATGATCCGAGTCAGGCGGGGCAACCGCTGGATAGTACGCCATGGGTTTATGACAGTGTT
TTCTATAAGGAGACGAGGAGTGGTCAGGCGCCCTATTCGCTGAGTAGTGACAGGAGGCTGAGTAATTACAGTGAG
ACGTCAGAGGCTTGGTCCACATTCGCTGATAGTATCTCATCCTGG
GCTGCTGTCTTCGTCCCCGCGTGGAATAAATTCAGTGTTATTGGTAACGATGTGGGGAGTTTGCAGGACTGTTCCTATCTGGTACCGCAGGGTCAGGTGAGTCGAAAGAGAGCTTATGTA
AATGCGATGTTTCGGGAGAAGATGGCTGCGAGGTTCAAACTTCGAGAAAGCGGCGAAACAGATTGA

Retrieve as FASTA