Entry information : AdelCIIBA15 (MnP5-atypical)
Entry ID 9703
Creation 2011-11-16 (Christophe Dunand)
Last sequence changes 2011-11-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: AdelCIIBA15 (MnP5-atypical)
Name (synonym) AdelCIIBA15 (MnP5-atypical)
Class Other class II peroxidase type A    [Orthogroup: CIIBA002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelCIIBA15
start..stop
S start..stop
AdelCIIBA16 588 0 1..355 1..355
AdelCIIBA01 503 1e-180 14..355 6..347
AdelCIIBA12 433 3e-153 22..352 16..347
AdelCIIBA13 427 1e-150 1..355 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 27854..27902 49 N° 2 27954..28053 100 N° 3 28105..28151 47 N° 4 28200..28274 75
N° 5 28326..28425 100 N° 6 28478..28553 76 N° 7 28601..28660 60 N° 8 28721..28980 260
N° 9 29030..29073 44 N° 10 29126..29369 244 N° 11 29418..29430 13  
join(27854..27902,27954..28053,28105..28151,28200..28274,28326..28425,28478..285 53,28601..28660,28721..28980,29030..29073,29126..29369,29418..29430)


exon

Literature and cross-references AdelCIIBA15 (MnP5-atypical)
DNA ref. JGI genome:   scaffold_88 (27854..29430)
Protein sequence: AdelCIIBA15 (MnP5-atypical)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (338)
PWM (Da):   %s   37376.47 (35601.5)  
PI (pH):   %s   4.28 (4.28) Peptide Signal:   %s   cut: 18 range:18-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MISTSLVLFTIVNTALAAVVPRATCADGTTVKNAACCAFIPVRDALINDIFEGQCGENAHSTVRAFHDAAGWSDFSDKGGGADGSMIAFGDIELNFEANAGIDEIVEDLQPFAIQHGISFGDVIHFGSSVALSLCPGAPLVQTFVGRNATAPAPDGTVPDPFNTITDILARMLDMGFQPDEVIALLASHTIAAQDEIEPAINRSPFDSTPGVFDSQVFLEVQLRGTLFPGDGSHLGQVESPMPGEFRLQSDHLFARDPRTACTWQSFLDQKLMASKFATAMAKLSLLGQFPDQLTDCTEIIPKAAPTPVGKAFFPAGQTHNNIEQACATQLFPTTLSTASGPATTVSRVPEQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (10 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCTCCACTTCCCTTGTCCTCTTCACCATCGTCAACACGGCGCTCGGTAAGTTTCACATCTCAGAGGCAGGGGATCCCGTACTGACCACCATCTTAGCCGCTGTGGTTCCTCGCGCG
ACCTGCGCGGACGGAACAACCGTGAAGAATGCCGCATGCTGCGCATTCATCCCGGTCCGCGATGCTCTCATCAATGATAT
GTGGGTCTCTTGAAATTGATCTCATGCCCTCTCGACTTAC
CACGCTCACAGTTTCGAGGGCCAGTGCGGCGAGAATGCGCACTCCACTGTCCGCATCGGTATGTAGGCCTTCGATCGAATACGAATAGAGATCTTATTCTGGGCAGCATTCCACGATGCC
GCTGGCTGGAGCGACTTCAGCGACAAGGGTGGAGGTGCCGACGGCAGCATGATCGCCTTCG
GTATGCGCTTGCACGGCCGGGAACTCGGGACTTCGCTGATATCCCTACTAGGCGACATC
GAGCTGAACTTCGAGGCCAACGCGGGGATTGACGAGATTGTCGAGGACCTCCAGCCGTTCGCGATCCAGCATGGGATCTCCTTCGGCGATGT
GTACGCCGCACGGAATCACCCCGTATCC
CGTCGCTGATACCAAGTCCCACAGCATCCACTTCGGGTCCTCGGTTGCATTGTCGCTGTGCCCCGGCGCGCCGCTCGTGCAAACATTCGTCGGCCGTGCCGTCAGTACTCGTGCGACGCG
CTCGCCCCTAGTCTCACACGCAAGCAGAACGCGACGGCGCCCGCGCCCGACGGCACCGTCCCGGATCCGTTCAACACCATCACCGACGTCAGTACCTCTCAGTTGCACCGCACCTCACTC
CTCGTGGTCTCACATTAGGATTCGCAGATTCTCGCGCGCATGCTCGATATGGGATTCCAGCCCGATGAGGTCATCGCTTTGCTTGCGAGCCACACCATCGCGGCGCAAGACGAGATTGAG
CCTGCCATCAACCGCTCGCCATTCGACTCAACGCCCGGTGTCTTCGACTCCCAAGTATTCCTCGAAGTCCAGCTGCGTGGGACGCTCTTCCCCGGCGACGGCTCTCATCTCGGCCAAGTC
GAAAGCCCTATGCCAGGCGAATTCCGTCTCCAGTCTGACCACCTCTT
GTACGTCAAGTTGTGAAAGAGCTCTCGCGGAGCCTCACGCGCTTCGCAGCGCACGCGATCCGCGCACTGCTTG
CACATGGCAGTCCTTCGCCC
GTACGTCTCTGCGCTCTCAACGTTGATGGCCTTGCTCATACATTGGTCTCAGTTGACCAGAAGCTCATGGCCAGCAAATTCGCGACCGCGATGGCGAAGC
TCAGCCTTCTCGGCCAATTCCCCGACCAGCTGACCGACTGCACGGAGATTATCCCGAAGGCGGCCCCGACTCCCGTGGGAAAGGCATTCTTCCCCGCTGGCCAGACGCACAACAACATCG
AGCAGGCGTGCGCAACCCAGCTCTTCCCGACGACGCTGTCCACCGCGTCTGGGCCGGCCACCACTGTGTCACGGGT
GTACGTACATCTCACATTCGACGCTTACCCCATGCTGACGCTAT
GAAGTCCCGAGCAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCTCCACTTCCCTTGTCCTCTTCACCATCGTCAACACGGCGCTCGCCGCTGTGGTTCCTCGCGCGACCTGCGCGGACGGAACAACCGTGAAGAATGCCGCATGCTGCGCATTCATC
CCGGTCCGCGATGCTCTCATCAATGATAT
TTTCGAGGGCCAGTGCGGCGAGAATGCGCACTCCACTGTCCGCATCGCATTCCACGATGCCGCTGGCTGGAGCGACTTCAGCGACAAGGGT
GGAGGTGCCGACGGCAGCATGATCGCCTTCG
GCGACATCGAGCTGAACTTCGAGGCCAACGCGGGGATTGACGAGATTGTCGAGGACCTCCAGCCGTTCGCGATCCAGCATGGGATCTCC
TTCGGCGATGT
CATCCACTTCGGGTCCTCGGTTGCATTGTCGCTGTGCCCCGGCGCGCCGCTCGTGCAAACATTCGTCGGCCGTGCCAACGCGACGGCGCCCGCGCCCGACGGCACCGTC
CCGGATCCGTTCAACACCATCACCGAC
ATTCTCGCGCGCATGCTCGATATGGGATTCCAGCCCGATGAGGTCATCGCTTTGCTTGCGAGCCACACCATCGCGGCGCAAGACGAGATTGAG
CCTGCCATCAACCGCTCGCCATTCGACTCAACGCCCGGTGTCTTCGACTCCCAAGTATTCCTCGAAGTCCAGCTGCGTGGGACGCTCTTCCCCGGCGACGGCTCTCATCTCGGCCAAGTC
GAAAGCCCTATGCCAGGCGAATTCCGTCTCCAGTCTGACCACCTCTT
CGCACGCGATCCGCGCACTGCTTGCACATGGCAGTCCTTCGCCCTTGACCAGAAGCTCATGGCCAGCAAATTC
GCGACCGCGATGGCGAAGCTCAGCCTTCTCGGCCAATTCCCCGACCAGCTGACCGACTGCACGGAGATTATCCCGAAGGCGGCCCCGACTCCCGTGGGAAAGGCATTCTTCCCCGCTGGC
CAGACGCACAACAACATCGAGCAGGCGTGCGCAACCCAGCTCTTCCCGACGACGCTGTCCACCGCGTCTGGGCCGGCCACCACTGTGTCACGGGT
TCCCGAGCAGTAA

Retrieve as FASTA