Entry information : AdelCIIBA17 (GP1)
Entry ID 9704
Creation 2011-11-16 (Christophe Dunand)
Last sequence changes 2011-11-16 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: AdelCIIBA17 (GP1)
Name (synonym) AdelCIIBA17 (GP1)
Class Other class II peroxidase type A    [Orthogroup: CIIBA002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelCIIBA17
start..stop
S start..stop
AdelCIIBA10 594 0 25..364 24..364
AdelCIIBA03 585 0 27..365 25..364
AdelCIIBA02 584 0 25..365 24..365
AdelCIIBA14 583 0 2..364 4..366
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 451391..451439 49 N° 2 451284..451339 56 N° 3 451210..451227 18 N° 4 451136..451161 26
N° 5 450940..451082 143 N° 6 450839..450881 43 N° 7 450645..450786 142 N° 8 450571..450590 20
N° 9 450504..450511 8 N° 10 450382..450451 70 N° 11 450187..450329 143 N° 12 450036..450134 99
N° 13 449881..449981 101 N° 14 449749..449823 75 N° 15 449631..449698 68 N° 16 449548..449584 37
complement(join(449548..449584,449631..449698,449749..449823,449881..449981,4500 36..450134,450187..450329,450382..450451,450504..450511,450571..450590,450645..4 50786,450839..450881,450940..451082,451136..451161,451210..451227,451284..451339 ,451391..451439))


exon

Literature and cross-references AdelCIIBA17 (GP1)
DNA ref. JGI genome:   scaffold_7 (451439..449548)
Protein sequence: AdelCIIBA17 (GP1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365 (348)
PWM (Da):   %s   38426.28 (36844.4)  
PI (pH):   %s   4.66 (4.66) Peptide Signal:   %s   cut: 18 range:18-365
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFAAPLVALALSAIAAASPTATTRCADGTVVANSCCFWANVRDRFINEIFLGVCQENVHSLVRIAFHDAIGFSLNSNKGGGADGSIIQFGATELAHANEGIDFIVDFLQPFADTVKITYGDAIQFGAAVGLSLCPGAPRIPAFVGRKNATQAAPDLVPEPTDDPVIFARMKDAGFTPVELVHLLASHSIADQAGVDPEESVLGAPFDSTPFSFDSQVFLETMLKGVLFPGSGPNGEVTSPLPGEFRLQSDKRFTVHNATACAWQANALSQSAMASNFQTAFSKLSLLGQNKNSLLDCSELATPPPATQRQAFFPPGKRHIDIEQGCATQAFPTTLSTAAGTPTPIPPVQVQDIPFGRKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (15 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCCGCACCTCTTGTCGCCCTCGCTCTCTCAGCCATTGCGGCAGGTAGGCGTCGAACATGTGCACTTCTGATGTCTCACAATTCACCCCTCTCAGCGTCTCCCACCGCCACCACG
AGGTGCGCGGACGGCACTGTCGTCGCCAACTCTCAG
GTACGTCTCTGCATGGAAGCTACTTTCTTTTTATCTGACGCAAGTCTTCTCTGTAGTGCTGCTTCTGGGCGAACGTGAGACGTC
GCCCTCCCAATTGGACAAGTCGTTAACGCTTGTTCTAGGTCCGCGACCGCTTTATCAACGAGATGTACGTTCGAACCTTACAATCAAATCCCGTCACTAGCACTCATTACCGTGTAGCTT
CCTCGGCGTTTGCCAGGAGAACGTGCACTCGCTTGTCCGGATCGCGTTCCACGACGCCATCGGGTTCTCCCTGAACTCCAACAAAGGCGGAGGTGCCGACGGGAGCATCATCCAGTTTGG
TGCAACGGAGTTGGCATTCC
GTCCGTATTCCCGCTCTCCACACTCGGCACCGCACTTACGCGCAGCTACATCTCGTAGACGCGAATGAGGGCATCGACTTCATCGTCGACTTCCTGCAAC
C
GTACGTGCAACGCTCACACTCGCAGGCGTAAGGGTTTACCGACATTTCGCAGGTTCGCCGACACCGTCAAGATCACCTACGGTGATGCTATTCAGTTTGGGGCGGCCGTTGGACTGTCT
CTGTGCCCCGGAGCCCCGAGGATCCCCGCATTCGTCGGGCGGAAGAACGCGACGCAAGCTGCACCGGACCTCACT
GTATGAATTACCCGTGACCGGAAGGTATCCCGCGCTGAACTACCC
TCTTTACAGGTCCCCGAGCCGACCGATGAGTCAGTGGACTCGGAAAACGATTGACTGTTGATAGACTAACTGGGTTCGTGTCTGTTAGCCCCGAAGGTGAGAAACCCGACAAGACAAGTC
ACTGCGCCATGACTAATGGATTCCCCAGTCATCTTTGCGCGCATGAAGGACGCGGGATTCACACCGGTTGAACTTGTCCATCTCCTCGCATCGCACAGGTCAGTCCCAAACCCAGTGCTT
TAGGCCTACGATTTTCTCACCCTCGTCCAGTATCGCCGATCAGGCTGGTGTCGACCCTGAGGAGTCTGTTCTCGGAGCGCCGTTCGACTCGACGCCGTTCAGCTTCGACTCGCAAGTCTT
CCTGGAGACCATGCTCAAGGGCGTTCTCTTCCCCGGCTCTGGCCCGAACCCAG
GTATGCTCTCCTCCCCGTATTCGAAGCACAAGGCGACTGAGCTTCCACGTAGGTGAGGTGACTAGCC
CGCTCCCGGGCGAGTTCCGCCTTCAGTCCGACAAGCGCTTCACGGTCCACAACGCGACTGCGTGCGCGTGGCAGGCCAACGCTT
GTAAGTCTATTCTCTCACATATCGAGAAGAACACCC
TCCGAGCGCACCGTCCAGTGAGCCAGTCGGCCATGGCGTCCAACTTCCAGACGGCGTTCAGCAAGCTCTCGCTGCTCGGCCAGAACAAGAACTCTCTCCTCGATTGCAGCGAGCTGATTG
TGCGCATTTACACTCTGGGAAACATCTGGCGATGTTCCTAATCATGATATGACCAGGCCACGCCTCCCCCAGCGACCCAGCGCCAGGCCTTCTTCCCACCCGGGAAGCGCCACATTGATA
TCGAGCAGGGG
GTGCGATTGTGTCAGCACTTGTGTGACTGGTACTCACTGTCTCCACATAGTGCGCAACTCAGGCATTCCCGACGACTTTGTCCACCGCGGCCGGCACGCCCACCCCGAT
CCCGCCCGT
GTACGCCGTGCTCATCACTTTTCTACGCAATCTGACCCCCGCGTAGCCAGGTCCAGGACATCCCCTTCGGCCGCAAGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCCGCACCTCTTGTCGCCCTCGCTCTCTCAGCCATTGCGGCAGCGTCTCCCACCGCCACCACGAGGTGCGCGGACGGCACTGTCGTCGCCAACTCTCAGTGCTGCTTCTGGGCG
AAC
GTCCGCGACCGCTTTATCAACGAGATCTTCCTCGGCGTTTGCCAGGAGAACGTGCACTCGCTTGTCCGGATCGCGTTCCACGACGCCATCGGGTTCTCCCTGAACTCCAACAAAGGC
GGAGGTGCCGACGGGAGCATCATCCAGTTTGGTGCAACGGAGTTGGCATTCC
ACGCGAATGAGGGCATCGACTTCATCGTCGACTTCCTGCAACCGTTCGCCGACACCGTCAAGATCACC
TACGGTGATGCTATTCAGTTTGGGGCGGCCGTTGGACTGTCTCTGTGCCCCGGAGCCCCGAGGATCCCCGCATTCGTCGGGCGGAAGAACGCGACGCAAGCTGCACCGGACCTCACT
GTC
CCCGAGCCGACCGATGA
CCCCGAAGTCATCTTTGCGCGCATGAAGGACGCGGGATTCACACCGGTTGAACTTGTCCATCTCCTCGCATCGCACAGTATCGCCGATCAGGCTGGTGTCGAC
CCTGAGGAGTCTGTTCTCGGAGCGCCGTTCGACTCGACGCCGTTCAGCTTCGACTCGCAAGTCTTCCTGGAGACCATGCTCAAGGGCGTTCTCTTCCCCGGCTCTGGCCCGAACCCAG
GT
GAGGTGACTAGCCCGCTCCCGGGCGAGTTCCGCCTTCAGTCCGACAAGCGCTTCACGGTCCACAACGCGACTGCGTGCGCGTGGCAGGCCAACGCTT
TGAGCCAGTCGGCCATGGCGTCC
AACTTCCAGACGGCGTTCAGCAAGCTCTCGCTGCTCGGCCAGAACAAGAACTCTCTCCTCGATTGCAGCGAGCTGATT
GCCACGCCTCCCCCAGCGACCCAGCGCCAGGCCTTCTTCCCA
CCCGGGAAGCGCCACATTGATATCGAGCAGGGG
TGCGCAACTCAGGCATTCCCGACGACTTTGTCCACCGCGGCCGGCACGCCCACCCCGATCCCGCCCGTCCAGGTCCAGGACATCCCC
TTCGGCCGCAAGAAGTAA

Retrieve as FASTA