Entry information : AdelCIIBA14 (MnP4-atypical)
Entry ID 9706
Creation 2011-11-16 (Christophe Dunand)
Last sequence changes 2011-12-07 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: AdelCIIBA14 (MnP4-atypical)
Name (synonym) AdelCIIBA14 (MnP4-atypical)
Class Other class II peroxidase type A    [Orthogroup: CIIBA002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelCIIBA14
start..stop
S start..stop
AdelCIIBA10 615 0 25..366 23..364
AdelCIIBA04 611 0 4..366 2..364
AdelCIIBA02 601 0 25..366 23..364
AdelCIIBA03 599 0 28..366 25..363
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 171826..171880 55 N° 2 171714..171769 56 N° 3 171643..171660 18 N° 4 171562..171587 26
N° 5 171366..171508 143 N° 6 171274..171316 43 N° 7 171051..171220 170 N° 8 170781..170993 213
N° 9 170633..170731 99 N° 10 170478..170578 101 N° 11 170352..170426 75 N° 12 170225..170292 68
N° 13 170141..170174 34  
complement(join(170141..170174,170225..170292,170352..170426,170478..170578,1706 33..170731,170781..170993,171051..171220,171274..171316,171366..171508,171562..1 71587,171643..171660,171714..171769,171826..171880))


exon

Literature and cross-references AdelCIIBA14 (MnP4-atypical)
DNA ref. JGI genome:   scaffold_70 (171880..170141)
Protein sequence: AdelCIIBA14 (MnP4-atypical)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366 (347)
PWM (Da):   %s   38135.99 (36348.0)  
PI (pH):   %s   4.45 (4.45) Peptide Signal:   %s   cut: 20 range:20-366
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFALASSLITLALAGSAVAAPAATLCPDGVHSTVNPCCFWANVRDRFINEIFLGVCQENVHSLVRIAFHDAIGFSLTSNKGGGSDGSIIQFKGTELAHANEGIDVIVDFLEPFANAVGAGFGDAIQFGAAVGLSLCPGAPRIPAFVGRPNATQAAPDGTVPEPFDAPKIFARMADAGFTPVELVHLLASHSIADQAGVDPEPQVLGAPFDSTPFSFDSQVFLEVMLRGTLFPGSGPNSGEDMSPLPGEFRLLSDRVFARHNETACAWQANALSQATMVSNFQTAFSKLSLLGHDKNSLLDCSELATPPPATAKQANFPPGKTHADIEQGCATLAFPTTLSTAAGQPTPIPPVQVQDIAFGRK

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns). Uncorrect prediction from JGI (splicing error intron 8).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCTCTGGCATCCTCGCTCATCACCCTCGCCCTCGCGGGTTCTGCTGTTGGTTTGTGGCTTCAGACTTAGGATGCTGCGCAGTGGAGTTGACTTCGCACGCTCCAGCTGCTCCAG
CTGCTACTCTGTGCCCGGATGGAGTGCATAGCACCGTCAACCCGCAG
GTGAGCCCACCGCGCACCGACCACCGCCGTTCTGCCTAATAATACCTTCTCAGTGCTGCTTCTGGGCGAACGT
ATGCCTTCGCTCATAATACATCCACCGAGCACGCTCAGTCAATTATTTCTTAGGTCCGCGACAGGTTCATCAACGAAATGTGAGCTCTCCACTGCTTTCGTCTTTCACATCGGCTTACGC
GGACCCGCGCAGCTTCCTCGGCGTGTGCCAGGAGAACGTGCACTCACTCGTCCGGATTGCGTTCCACGATGCAATCGGGTTCTCCCTCACCTCGAACAAGGGCGGTGGCTCGGACGGGAG
CATCATCCAGTTCAAGGGCACAGAGCTCGCGTTCC
GTCCGTCCTCCGTATCGCGCGTGAATTCAAGTTTCTGACCCTCTCTAAGATGCAAACGAGGGCATTGATGTGATTGTCGACTTCC
TCGAGCC
GTCAGTGGTGTAACGTTTTCAGCGAATTTGGGCTGACTGGCGCTACTCCAAAGGTTCGCGAACGCAGTGGGCGCAGGGTTCGGAGACGCCATCCAGTTCGGCGCGGCCGTCGG
CCTCTCTCTCTGCCCCGGCGCGCCGCGCATCCCCGCGTTCGTCGGGCGCCCGAATGCGACGCAGGCCGCTCCGGACGGCACGGTTCCCGAGCCGTTTGATGCCCCCGAGA
GTGCGCCCTC
CCATCCGCCCCGACGCGAAACCCGCTGCTGACCGCAACGGACCGCAGAGATCTTCGCGCGGATGGCGGACGCGGGCTTCACGCCCGTAGAGCTCGTGCACCTCCTCGCGTCGCACAGCAT
CGCTGACCAGGCCGGCGTCGACCCCGAGCCGCAGGTGCTCGGCGCGCCGTTCGACTCGACGCCCTTCAGCTTCGACTCGCAGGTCTTCCTCGAGGTCATGCTCCGCGGCACGCTCTTCCC
CGGCTCCGGGCCCAACTCCG
GCGCGTCATCCCGTTGCTTTCCAAGGCAAAGTAGGCTGATGCATCGTAGGCGAGGACATGAGCCCGCTTCCGGGCGAGTTCCGCCTGCTGTCCGACCGTG
TGTTTGCGCGCCACAACGAGACCGCTTGCGCGTGGCAGGCGAACGCTC
GTACGCCCCTCGCTGCGATTGCCGTCGGAATTGTGGCTGAGTACAGGCGGATAGTGAGCCAGGCGACGATGG
TATCGAACTTCCAGACGGCGTTCAGCAAGCTCTCGCTCCTCGGCCACGATAAGAACTCCCTGCTTGACTGCAGCGAGCTCATT
GTGCGTCGTTCGCAACATGGGGTCGTGTGTATCATCT
AACAGACTTCGCAGGCGACTCCACCCCCGGCGACGGCGAAGCAGGCCAACTTCCCACCGGGCAAGACCCACGCTGACATCGAGCAAGGCGTATGTCCCGTGCTAATCGACTACCCTGAGA
TCCTGACTAACTACCTCTCCCTGTGTAGTGCGCGACCCTCGCCTTCCCGACTACTCTTTCCACTGCGGCCGGCCAGCCCACTCCTATTCCTCCTGTGTACGTGGGATTGCCTCCCGCCGT
TGGGATCGCCGCTGATCGTGGAACAGCCAAGTGCAGGATATTGCCTTCGGCAGGAAGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCTCTGGCATCCTCGCTCATCACCCTCGCCCTCGCGGGTTCTGCTGTTGCTGCTCCAGCTGCTACTCTGTGCCCGGATGGAGTGCATAGCACCGTCAACCCGCAGTGCTGCTTC
TGGGCGAAC
GTCCGCGACAGGTTCATCAACGAAATCTTCCTCGGCGTGTGCCAGGAGAACGTGCACTCACTCGTCCGGATTGCGTTCCACGATGCAATCGGGTTCTCCCTCACCTCGAAC
AAGGGCGGTGGCTCGGACGGGAGCATCATCCAGTTCAAGGGCACAGAGCTCGCGTTCC
ATGCAAACGAGGGCATTGATGTGATTGTCGACTTCCTCGAGCCGTTCGCGAACGCAGTGGGC
GCAGGGTTCGGAGACGCCATCCAGTTCGGCGCGGCCGTCGGCCTCTCTCTCTGCCCCGGCGCGCCGCGCATCCCCGCGTTCGTCGGGCGCCCGAATGCGACGCAGGCCGCTCCGGACGGC
ACGGTTCCCGAGCCGTTTGATGCCCCCGAGA
AGATCTTCGCGCGGATGGCGGACGCGGGCTTCACGCCCGTAGAGCTCGTGCACCTCCTCGCGTCGCACAGCATCGCTGACCAGGCCGGC
GTCGACCCCGAGCCGCAGGTGCTCGGCGCGCCGTTCGACTCGACGCCCTTCAGCTTCGACTCGCAGGTCTTCCTCGAGGTCATGCTCCGCGGCACGCTCTTCCCCGGCTCCGGGCCCAAC
TCCG
GCGAGGACATGAGCCCGCTTCCGGGCGAGTTCCGCCTGCTGTCCGACCGTGTGTTTGCGCGCCACAACGAGACCGCTTGCGCGTGGCAGGCGAACGCTCTGAGCCAGGCGACGATG
GTATCGAACTTCCAGACGGCGTTCAGCAAGCTCTCGCTCCTCGGCCACGATAAGAACTCCCTGCTTGACTGCAGCGAGCTCATT
GCGACTCCACCCCCGGCGACGGCGAAGCAGGCCAAC
TTCCCACCGGGCAAGACCCACGCTGACATCGAGCAAGGC
TGCGCGACCCTCGCCTTCCCGACTACTCTTTCCACTGCGGCCGGCCAGCCCACTCCTATTCCTCCTGTCCAAGTGCAGGAT
ATTGCCTTCGGCAGGAAGTGA

Retrieve as FASTA