Entry information : AdelCIIBA16 (MnP6-atypical)
Entry ID 9712
Creation 2011-11-16 (Christophe Dunand)
Last sequence changes 2011-11-16 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: AdelCIIBA16 (MnP6-atypical)
Name (synonym) AdelCIIBA16 (MnP6-atypical)
Class Other class II peroxidase type A    [Orthogroup: CIIBA002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelCIIBA16
start..stop
S start..stop
AdelCIIBA15 601 0 1..355 1..355
AdelCIIBA01 490 9e-176 11..355 3..347
AdelCIIBA13 435 9e-154 2..355 6..361
AdelCIIBA12 412 8e-145 14..349 8..344
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 627814..627862 49 N° 2 627705..627760 56 N° 3 627608..627651 44 N° 4 627509..627555 47
N° 5 627383..627457 75 N° 6 627231..627330 100 N° 7 627037..627172 136 N° 8 626419..626979 561
complement(join(626419..626979,627037..627172,627231..627330,627383..627457,6275 09..627555,627608..627651,627705..627760,627814..627862))


exon

Literature and cross-references AdelCIIBA16 (MnP6-atypical)
DNA ref. JGI genome:   scaffold_8 (627862..626419)
Protein sequence: AdelCIIBA16 (MnP6-atypical)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355 (338)
PWM (Da):   %s   37271.42 (35627.5)  
PI (pH):   %s   4.16 (4.16) Peptide Signal:   %s   cut: 18 range:18-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MISAALLTSAFLAVALAAVVPRTTCADGTTVKDACCAFIPVRDALINDIFEGTCGENAHSTVRAFHDAAGWSDFSNKGGGADGSMIQFGDIELAFEANAGIDEIVDDLKPFALQHGISFGDVIHFGSSVALSLCPGAPLVQTFVGRGNATEPAPDGTVPDPFNPVDILDRMLDMGFQPDELIALLASHSIAAQDEIEPAIDRTPFDSSPALFDSQVFLEVQLSGTLFPGNGSHQGEVESPLPGEFRLQSDHLLARDPRTACTWQSFALDQALMASKFATTMAKLSLRGQDPNKLTDCTEIIPKAAPAALNQAFFPPGKTIADIDQACAAQLFPTTLSTQAGATTTVMRVPEQ*

Retrieve as FASTA  
Remarks complete sequence from genomic (7 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATTTCTGCCGCTCTTCTGACCTCGGCATTCCTGGCTGTTGCTCTTGGTGAGATACACTCACATGAATGACTACGCCCCGGGTTAATGATCGCCTCATAGCTGCGGTTGTGCCGCGCA
CGACATGCGCAGACGGTACCACGGTCAAGGATGCGGCA
GTACGCCCCTCGCGTCGACTGTGATCGCCCACAACTGACGTCCCCTCGTCGAGTGCTGCGCCTTCATCCCTGTTCGCGATGC
TCTCATCAACGACAT
GTATGCCATATTTGTCGCACTGATCAACCCTTCGAGCTGATCTATGCAACAGCTTTGAGGGGACGTGCGGCGAAAATGCTCACTCCACCGTTCGCATCGGTACGG
TGCACTGCTTCACTTGCTTGATTGATCCTAATTACAACCCCCCAGCGTTCCACGATGCTGCCGGATGGAGTGACTTCAGCAACAAAGGCGGGGGCGCCGATGGTAGCATGATCCAATTCG
GTGCGTAATTGTCATCAAGAAAACGCGGACGACGAGTTCGACGTTCACTTAGGGGACATCGAACTTGCCTTCGAAGCGAACGCGGGAATCGACGAGATCGTCGATGACCTAAAGCCTTTT
GCACTGCAGCACGGAATATCATTTGGGGATGT
GTATGTCTACACACTCTCCCTTTGTGTTTGCTGAGCTGAAGCGTCCAAATCACCGTAGCATCCACTTCGGTTCCTCGGTCGCACTCTC
CTTGTGCCCAGGGGCGCCGTTGGTGCAGACTTTCGTGGGTCGTGGCAACGCCACGGAGCCTGCACCCGATGGCACGGTTCCGGACCCATTCAACCCGGTTGATCAG
GTATGCATCGGGTT
CAATATTTACTATGGCTTTTCTCAAAAGGAATACCGATCATAGATTCTCGACCGGATGCTCGACATGGGCTTCCAGCCGGACGAACTCATCGCCCTTCTCGCAAGCCATTCGATCGCCGC
GCAGGACGAGATTGAGCCCGCCATTGACCGGACGCCATTCGACTCCTCCCCGGCGCTCTTCGATTCTCAAGTCTTCCTCGAGGTCCAGCTCTCCGGGACGCTCTTCCCGGGCAATGGCTC
GCACCAGGGCGAAGTAGAGTCGCCCCTCCCGGGCGAGTTCCGCCTGCAATCCGACCATCTCCTGGCGCGCGACCCGCGCACGGCCTGCACGTGGCAATCCTTCGCACTAGACCAGGCGCT
CATGGCGAGCAAGTTCGCCACGACTATGGCAAAGCTCAGCCTGCGCGGCCAGGACCCGAACAAGCTGACCGACTGCACGGAGATCATTCCCAAAGCCGCGCCCGCGGCGCTCAACCAGGC
GTTCTTCCCGCCGGGCAAGACGATCGCGGACATTGACCAGGCATGCGCCGCCCAGCTGTTCCCGACCACACTCTCGACCCAGGCCGGCGCTACGACGACCGTCATGCGCGTGCCGGAGCA
GTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATTTCTGCCGCTCTTCTGACCTCGGCATTCCTGGCTGTTGCTCTTGCTGCGGTTGTGCCGCGCACGACATGCGCAGACGGTACCACGGTCAAGGATGCGGCATGCTGCGCCTTCATC
CCTGTTCGCGATGCTCTCATCAACGACAT
CTTTGAGGGGACGTGCGGCGAAAATGCTCACTCCACCGTTCGCATCGCGTTCCACGATGCTGCCGGATGGAGTGACTTCAGCAACAAAGGC
GGGGGCGCCGATGGTAGCATGATCCAATTCG
GGGACATCGAACTTGCCTTCGAAGCGAACGCGGGAATCGACGAGATCGTCGATGACCTAAAGCCTTTTGCACTGCAGCACGGAATATCA
TTTGGGGATGT
CATCCACTTCGGTTCCTCGGTCGCACTCTCCTTGTGCCCAGGGGCGCCGTTGGTGCAGACTTTCGTGGGTCGTGGCAACGCCACGGAGCCTGCACCCGATGGCACGGTT
CCGGACCCATTCAACCCGGTTGATCAG
ATTCTCGACCGGATGCTCGACATGGGCTTCCAGCCGGACGAACTCATCGCCCTTCTCGCAAGCCATTCGATCGCCGCGCAGGACGAGATTGAG
CCCGCCATTGACCGGACGCCATTCGACTCCTCCCCGGCGCTCTTCGATTCTCAAGTCTTCCTCGAGGTCCAGCTCTCCGGGACGCTCTTCCCGGGCAATGGCTCGCACCAGGGCGAAGTA
GAGTCGCCCCTCCCGGGCGAGTTCCGCCTGCAATCCGACCATCTCCTGGCGCGCGACCCGCGCACGGCCTGCACGTGGCAATCCTTCGCACTAGACCAGGCGCTCATGGCGAGCAAGTTC
GCCACGACTATGGCAAAGCTCAGCCTGCGCGGCCAGGACCCGAACAAGCTGACCGACTGCACGGAGATCATTCCCAAAGCCGCGCCCGCGGCGCTCAACCAGGCGTTCTTCCCGCCGGGC
AAGACGATCGCGGACATTGACCAGGCATGCGCCGCCCAGCTGTTCCCGACCACACTCTCGACCCAGGCCGGCGCTACGACGACCGTCATGCGCGTGCCGGAGCAGTAG

Retrieve as FASTA