Entry information : AdelCIIBA01 (MnP2-atypical)
Entry ID 9713
Creation 2011-11-16 (Christophe Dunand)
Last sequence changes 2011-11-22 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-10-26 (Nizar Fawal)
Peroxidase information: AdelCIIBA01 (MnP2-atypical)
Name (synonym) AdelCIIBA01 (MnP2-atypical)
Class Other class II peroxidase type A    [Orthogroup: CIIBA002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelCIIBA01
start..stop
S start..stop
AdelCIIBA15 520 0 6..347 14..355
AdelCIIBA16 501 4e-180 14..347 22..355
AdelCIIBA13 428 3e-151 17..347 29..361
AdelCIIBA12 409 6e-144 10..344 12..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46926..46961 36 N° 2 46798..46842 45 N° 3 46708..46751 44 N° 4 46616..46657 42
N° 5 46543..46562 20 N° 6 46468..46492 25 N° 7 46378..46415 38 N° 8 46306..46323 18
N° 9 46174..46252 79 N° 10 45588..46128 541 N° 11 45460..45534 75 N° 12 45338..45405 68
N° 13 45273..45285 13  
complement(join(45273..45285,45338..45405,45460..45534,45588..46128,46174..46252 ,46306..46323,46378..46415,46468..46492,46543..46562,46616..46657,46708..46751,4 6798..46842,46926..46961))


exon

Literature and cross-references AdelCIIBA01 (MnP2-atypical)
DNA ref. JGI genome:   scaffold_39 (46961..45273)
Protein sequence: AdelCIIBA01 (MnP2-atypical)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   347 (330)
PWM (Da):   %s   36347.82 (34537.9)  
PI (pH):   %s   4.21 (4.17) Peptide Signal:   %s   cut: 18 range:18-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVFLATSVLAFAQRATCSDGTVVSNAQCCQFIQVRDDLLNDVFEGLCGENAHSTIRIAFHDIGFSQAGGKGGGADGSIIQFDIELPFEANNGIDEIVEVLQPFALDHGISFADVIHFGSSVALSLCPGAPTVQTFVGRPNATAPAPDGTVPDPFNPVTDILARMAEAGFSPDEVVALLASHSVAAQDKVEPAIDRSPFDSTPATFDNQIFLETMLRGVLFPGDGAHEGEVESPLPGEFRLQSDGAFARDSRTACTWQSLALDHNAMSSKFSTAMTKLNLLGQNQALLADCTELPAAPSVPNKQAFFPAGKTHNDIEQACATLAFPTTLSTQAGATMTVARVPEQ

Retrieve as FASTA  
Remarks Complete sequence from genomic (12 introns). Incorrect prediction from JGI (second intron is not predicted).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCCTCGCCACATCTGTCCTCGCGTTCGCTGTCGGCTCTTATGGCGAGTCTCTCTCACATGTTCTCTCGTTTTCGGTAAACTAATGAAAGGTTTTCTAGGTGCCGCCGTCAAGC
AAAGAGCTACCTGCTCTGATGGGACCGTTGTTAGCAACGCGCAG
GTGCGTCTACCGTGAAGGATGATCGATGAATCTTACACTTTGACAGTGCTGCCAGTTCATCCAGGTGCGCGACGAC
CTTCTCAACGATGT
GTATGTACCACACGTCGACTCTCCCACGCGGGCTGAGCTTCCATCGATAGCTTCGAGGGCCTGTGCGGTGAGAATGCGCACTCGACCATCCGGTATGAACACCACC
TTTTTGCGCGAGTATTACTGGTGGCTCATGGGATCCCAGCATTGCTTTCCACGACGCAAGTGGGTCTTGAATACAAACGCATTTTACCGGAACTAAGACATCCTTTCAGTTGGCTTCTCT
CAGGCTGGCGGAAA
GTGAGATACTGATTTTTCGGATTGGCGAACGAGCCTGACGCGGTACTTTCAGAGGTGGGGGTGCAGATGGTAGCATCATCCAATTCGGAGGTGAGGCTGCCCCTCT
TACATGATAGCAACTACCGCGCTGACCTTGCGTCGTAGACATCGAACTTCCTTTCGGTAAGGACGAACTGATTGCGGGGCGATGGTCGGAGTTGACAGAGTTCTCGCAGAGGCGAACAAT
GGTATCGACGAAATCGTCGAGGTCCTGCAACCTTTCGCTCTGGACCATGGTATCAGCTTCGCGGACGT
GTACGTGGACAGGCTTGAGCCATTCGCGCCCCTGACAGTTTTCAGGATCCAC
TTCGGTTCCTCCGTCGCGCTGTCCCTGTGCCCTGGTGCCCCGACCGTGCAGACCTTCGTCGGCCGTCCAAATGCCACGGCACCAGCGCCTGACGGCACGGTTCCGGACCCATTCAACCCG
GTCACCGACATTCTGGCGCGCATGGCCGAGGCGGGGTTCAGCCCGGACGAGGTCGTCGCGCTGCTCGCGAGCCACTCGGTCGCCGCGCAGGACAAGGTCGAGCCCGCGATCGACCGCTCG
CCGTTCGACTCGACGCCCGCGACGTTCGACAACCAGATCTTCCTCGAGACGATGCTGCGCGGCGTGCTATTCCCCGGAGACGGCGCGCACGAGGGAGAGGTCGAGAGCCCATTGCCGGGC
GAGTTCCGCCTGCAGTCCGACGGCGCCTTCGCGCGCGACTCGCGCACGGCATGCACATGGCAGTCGCTCGCGCTCGACCACAACGCCATGAGCTCGAAGTTCTCAACCGCGATGACCAAG
CTCAACCTCCTCGGCCAGAACCAGGCCCTGTTGGCGGACTGCACGGAGCTCATC
GTAGGCTTTCCCGCCCTTCCCATTCTTGAGATCGAGCTAATTTCACTCTGCAGCCCGCGGCCCCCT
CTGTACCGAACAAGCAGGCATTCTTCCCTGCTGGGAAGACGCACAATGACATCGAGCAGGCG
GTGAGTCCCGCGATTCATTGTCTCGGCGCCCCAGCCAAACTGACCGCCGTGCAGTGCG
CAACTCTGGCTTTCCCGACCACGCTGTCTACGCAGGCCGGCGCGACAATGACCGTCGCTCGTGT
GTACGTCTTCATGTTCTCAGTGTCACGACAGCGACGCTGATTGATCTTGCAGTCCG
GAGCAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTCTTCCTCGCCACATCTGTCCTCGCGTTCGCTCAAAGAGCTACCTGCTCTGATGGGACCGTTGTTAGCAACGCGCAGTGCTGCCAGTTCATCCAGGTGCGCGACGACCTTCTCAAC
GATGT
CTTCGAGGGCCTGTGCGGTGAGAATGCGCACTCGACCATCCGCATTGCTTTCCACGACGCAATTGGCTTCTCTCAGGCTGGCGGAAAAGGTGGGGGTGCAGATGGTAGCATCATC
CAATTCGGAG
ACATCGAACTTCCTTTCGAGGCGAACAATGGTATCGACGAAATCGTCGAGGTCCTGCAACCTTTCGCTCTGGACCATGGTATCAGCTTCGCGGACGTGATCCACTTCGGT
TCCTCCGTCGCGCTGTCCCTGTGCCCTGGTGCCCCGACCGTGCAGACCTTCGTCGGCCGTCCAAATGCCACGGCACCAGCGCCTGACGGCACGGTTCCGGACCCATTCAACCCGGTCACC
GACATTCTGGCGCGCATGGCCGAGGCGGGGTTCAGCCCGGACGAGGTCGTCGCGCTGCTCGCGAGCCACTCGGTCGCCGCGCAGGACAAGGTCGAGCCCGCGATCGACCGCTCGCCGTTC
GACTCGACGCCCGCGACGTTCGACAACCAGATCTTCCTCGAGACGATGCTGCGCGGCGTGCTATTCCCCGGAGACGGCGCGCACGAGGGAGAGGTCGAGAGCCCATTGCCGGGCGAGTTC
CGCCTGCAGTCCGACGGCGCCTTCGCGCGCGACTCGCGCACGGCATGCACATGGCAGTCGCTCGCGCTCGACCACAACGCCATGAGCTCGAAGTTCTCAACCGCGATGACCAAGCTCAAC
CTCCTCGGCCAGAACCAGGCCCTGTTGGCGGACTGCACGGAGCTCATC
CCCGCGGCCCCCTCTGTACCGAACAAGCAGGCATTCTTCCCTGCTGGGAAGACGCACAATGACATCGAGCAG
GCG
TGCGCAACTCTGGCTTTCCCGACCACGCTGTCTACGCAGGCCGGCGCGACAATGACCGTCGCTCGTGTTCCGGAGCAGTAA

Retrieve as FASTA