Entry information : AdelCIIBA04 (GP4)
Entry ID 9714
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2011-11-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: AdelCIIBA04 (GP4)
Name (synonym) AdelCIIBA04 (GP4)
Class Other class II peroxidase type A    [Orthogroup: CIIBA002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelCIIBA04
start..stop
S start..stop
AdelCIIBA10 639 0 23..364 23..364
AdelCIIBA14 615 0 2..364 4..366
AdelCIIBA03 613 0 26..364 25..363
AdelCIIBA02 613 0 23..364 23..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 158901..158949 49 N° 2 159001..159056 56 N° 3 159110..159127 18 N° 4 159175..159200 26
N° 5 159252..159394 143 N° 6 159444..159486 43 N° 7 159536..159677 142 N° 8 159730..159757 28
N° 9 159806..159875 70 N° 10 159925..160067 143 N° 11 160124..160222 99 N° 12 160274..160374 101
N° 13 160426..160500 75 N° 14 160555..160622 68 N° 15 160678..160711 34  
join(158901..158949,159001..159056,159110..159127,159175..159200,159252..159394, 159444..159486,159536..159677,159730..159757,159806..159875,159925..160067,16012 4..160222,160274..160374,160426..160500,160555..160622,160678..160711)


exon

Literature and cross-references AdelCIIBA04 (GP4)
DNA ref. JGI genome:   scaffold_39 (158901..160711)
Protein sequence: AdelCIIBA04 (GP4)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (347)
PWM (Da):   %s   38130.91 (36627.0)  
PI (pH):   %s   4.34 (4.34) Peptide Signal:   %s   cut: 18 range:18-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIAAPLVALGLAGIAAAAPAASLCPDGVHSTVNPCCFWANVRDRFINEIFLNVCMENVHSLVRIAFHDAIGFSLTSNKGGGADGSIIQFGETELAHANEGIDFIVDFLQPFADTVGITYGDAIQFGAAVGLSLCPGAPRIPAFVGRPNATQAAPDKVPEPDDPPTTIFARMQDAGFSPVDLVHLLASHSIADQAGVDPEPQVLGAPFDSTPFSFDSQVFLEVLLRGSMFPGSGPNGEEQSPLSGEFRLLSDKVFARHNLTACAWQANALSQADMSSNFGTQFSKLSLLGHDKNSLLDCSELGTPPPATAKQAFFPAGKTHADIEQGCATVAFPTTLSTQTGQPTMIPLVQVQDIAFGKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (14 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCGCAGCACCTCTTGTCGCACTCGGTCTTGCAGGCATAGCCGCTGGTTCGTTATTGACCTCCTCAGCCTGGACCCAATCTGACGTCCGCCGCACAGCTGCCCCGGCGGCATCACTC
TGCCCTGACGGTGTGCACAGCACCGTAAACCCTCAG
GTTCGTGGAATGTACACCCTCACACTCTCAAGTATCTGATAATGCGCGTCCAGTGCTGCTTCTGGGCCAATGTAAGATACGACG
TTTCGTTGCTGGCCATCTAACTGGGCTCCTCCAGGTTCGCGACCGGTTCATCAACGAGATGTATGTGCACATGCAAACAATTTGTTACGCGATGCTAAGACCCTCTCATAGCTTCCTCAA
TGTTTGCATGGAGAACGTGCACTCGCTCGTCCGGATTGCCTTCCACGACGCGATCGGCTTCTCCCTAACATCCAACAAAGGCGGAGGCGCGGACGGCAGTATCATCCAATTCGGGGAGAC
TGAGCTCGCATTCC
GTAAGGAAAATCGTGCTGCATCGGTCTCGCATTTGACGCCCAATGATAGACGCCAACGAGGGCATCGACTTCATAGTCGACTTCCTCCAGCCGTACGTCCTCGGCC
GTAGAATAAATCGCTGTCCTGACTCCGGGGTTCAGATTCGCGGACACGGTCGGCATCACATACGGCGACGCTATTCAGTTTGGCGCGGCGGTCGGGCTCTCACTCTGCCCTGGGGCTCCC
AGAATTCCCGCCTTCGTCGGCCGTCCGAATGCCACTCAGGCCGCGCCGGACAAGACC
GTGAGATATCCTTTGACTGACGTTTTCAACCGGACTCTCACGTGCTTTCCAGGTCCCTGAGCC
AGATGACCCTCCGACCA
GTAAGCCACCTGCAGCGCCGGTCCGTGCCTTGCATTGAGTACATCTAGCCATCTTCGCGCGCATGCAGGACGCCGGCTTCTCGCCAGTGGACCTCGTCCATCT
TCTCGCATCTCACAG
GTACCTTGCCATTCCCACCGCAGTTTGACCCATTGCTTACGTGTTCTAGTATTGCCGACCAAGCCGGTGTCGACCCTGAGCCACAAGTTCTCGGGGCGCCGTTCG
ACTCGACGCCGTTCAGCTTCGACTCCCAGGTCTTCCTCGAGGTCCTCCTGCGCGGATCGATGTTCCCAGGCTCTGGGCCCAACCCCG
GTACGCCGCACCCCTCCCGTAGCCCGTCGGCCG
CATTCCTGCTGACAGGTTTCCAGGCGAGGAGCAGAGCCCGCTCTCTGGCGAATTCCGTCTCCTCTCGGACAAGGTCTTCGCGCGCCACAACCTCACCGCGTGCGCATGGCAGGCGAACGC
TC
GTGCGTAAACCCCCGCTCGCTAGGAGAGTAGATCGACTGACGCGACGACAGTGAGCCAGGCGGACATGTCGTCGAACTTCGGGACACAGTTCAGCAAGCTCTCGCTCCTTGGGCACGA
CAAGAATTCGCTTCTTGACTGCAGCGAGCTCATC
GTACATCCTGTTCTTGATGAATCGCAGATGACCCACTGACACTGGAACTAGGGTACGCCTCCGCCCGCGACGGCGAAGCAGGCATT
CTTCCCGGCCGGAAAGACGCACGCAGATATCGAGCAAGGC
GTACGTACCACGCCTCTTCCCTACATCTTTCAATTACTGACTCAGCGTGCGCAGTGCGCTACGGTGGCCTTCCCGACGAC
ACTCTCGACGCAGACCGGTCAGCCGACGATGATTCCTCTCGT
GTATGTATTCACTCTCTATCCCGCGGAGACAGACTTCTGACGCACGGACCTCTAGCCAAGTGCAGGACATCGCGTTCG
GCAAGAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCGCAGCACCTCTTGTCGCACTCGGTCTTGCAGGCATAGCCGCTGCTGCCCCGGCGGCATCACTCTGCCCTGACGGTGTGCACAGCACCGTAAACCCTCAGTGCTGCTTCTGGGCC
AAT
GTTCGCGACCGGTTCATCAACGAGATCTTCCTCAATGTTTGCATGGAGAACGTGCACTCGCTCGTCCGGATTGCCTTCCACGACGCGATCGGCTTCTCCCTAACATCCAACAAAGGC
GGAGGCGCGGACGGCAGTATCATCCAATTCGGGGAGACTGAGCTCGCATTCC
ACGCCAACGAGGGCATCGACTTCATAGTCGACTTCCTCCAGCCATTCGCGGACACGGTCGGCATCACA
TACGGCGACGCTATTCAGTTTGGCGCGGCGGTCGGGCTCTCACTCTGCCCTGGGGCTCCCAGAATTCCCGCCTTCGTCGGCCGTCCGAATGCCACTCAGGCCGCGCCGGACAAGACC
GTC
CCTGAGCCAGATGACCCTCCGACCA
CCATCTTCGCGCGCATGCAGGACGCCGGCTTCTCGCCAGTGGACCTCGTCCATCTTCTCGCATCTCACAGTATTGCCGACCAAGCCGGTGTCGAC
CCTGAGCCACAAGTTCTCGGGGCGCCGTTCGACTCGACGCCGTTCAGCTTCGACTCCCAGGTCTTCCTCGAGGTCCTCCTGCGCGGATCGATGTTCCCAGGCTCTGGGCCCAACCCCG
GC
GAGGAGCAGAGCCCGCTCTCTGGCGAATTCCGTCTCCTCTCGGACAAGGTCTTCGCGCGCCACAACCTCACCGCGTGCGCATGGCAGGCGAACGCTC
TGAGCCAGGCGGACATGTCGTCG
AACTTCGGGACACAGTTCAGCAAGCTCTCGCTCCTTGGGCACGACAAGAATTCGCTTCTTGACTGCAGCGAGCTCATC
GGTACGCCTCCGCCCGCGACGGCGAAGCAGGCATTCTTCCCG
GCCGGAAAGACGCACGCAGATATCGAGCAAGGC
TGCGCTACGGTGGCCTTCCCGACGACACTCTCGACGCAGACCGGTCAGCCGACGATGATTCCTCTCGTCCAAGTGCAGGACATCGCG
TTCGGCAAGAAGTAG

Retrieve as FASTA