Entry information : AdelCIIBA05 (GP5)
Entry ID 9716
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2011-11-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: AdelCIIBA05 (GP5)
Name (synonym) AdelCIIBA05 (GP5)
Class Other class II peroxidase type A    [Orthogroup: CIIBA002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelCIIBA05
start..stop
S start..stop
AdelCIIBA06 656 0 1..362 1..365
AdelCIIBA07 644 0 1..362 1..362
AdelCIIBA08 622 0 22..362 22..362
AdelCIIBA03 584 0 25..362 25..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 248586..248634 49 N° 2 248482..248534 53 N° 3 248415..248432 18 N° 4 248338..248363 26
N° 5 248146..248288 143 N° 6 248043..248085 43 N° 7 247817..247986 170 N° 8 247555..247767 213
N° 9 247401..247499 99 N° 10 247244..247344 101 N° 11 247116..247190 75 N° 12 246992..247059 68
N° 13 246910..246940 31  
complement(join(246910..246940,246992..247059,247116..247190,247244..247344,2474 01..247499,247555..247767,247817..247986,248043..248085,248146..248288,248338..2 48363,248415..248432,248482..248534,248586..248634))


exon

Literature and cross-references AdelCIIBA05 (GP5)
DNA ref. JGI genome:   scaffold_39 (248634..246910)
Protein sequence: AdelCIIBA05 (GP5)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (345)
PWM (Da):   %s   38515.24 (36913.4)  
PI (pH):   %s   4.82 (4.82) Peptide Signal:   %s   cut: 18 range:18-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFAASLITLALSGIAAAAPAATCPDGKHTAVNQCCFWANVRDRFINEIFLGVCQENVHSLIRIAFHDAIGFSLHSEKGGGADGSMIQFGDIELKPANEGIDFITAFLQPFADTVGITYGDAIQFGAAVGLSLCPGAPKIPAFVGRKNATRAAPDKTVPEPQDDLKIFARMDDAGFSPSELIHLLASHSVADQAGVDPEPQVLGAPFDSTPFEFDSQVFLEVMLRGTLFPGSGPNLGEDMSPLPGEFRLLSDRLFARDSRTACAWQENALDQAAMARNFQAAFTKLSLLGQNKNSLLDCSEVATAKPAREKQAHFPAGKSHADIEQGCATKLFPTTLSTQAGRPTMIPPVQVQDIPFGK

Retrieve as FASTA  
Remarks Complete sequence from genomic (12 introns)
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCCGCGTCCCTCATCACCCTCGCCCTCTCTGGCATCGCAGCGGGTTCGTGAAACGTTCAGGATCTCTCAGATGGCTAACAATGACTGTTCTCAGCCGCACCTGCTGCAACCTGC
CCCGATGGCAAGCACACCGCGGTCAACCAGCAG
GTACGAGTGTCGCTACTTCTTGCCACAAAATACCGACCTTTTGGAATAGTGCTGCTTCTGGGCCAATGTAGGCAGCATCGTTTGAAT
GCGCTTCTAGTTGCTCAACTCATCCTCGCAGGTCCGCGACCGGTTCATCAATGAGATGTGAGTCGTCCGCCCGTGCGTGCCAAGCAATGCTGACATAAGCTATCAGTTTCCTCGGAGTGT
GCCAAGAGAACGTCCACTCGCTCATCCGGATTGCCTTCCACGACGCGATTGGCTTCTCGCTGCACTCGGAAAAGGGTGGAGGCGCGGACGGCTCAATGATTCAGTTCGGCGACATCGAGC
TCAAGTACC
GTACGCGGAATTATCTCCATTCCCGCCGCCCGCGTGCTCTTTGCTGACGAGATCTGGTAGCCGCGAACGAGGGCATCGACTTCATCACCGCGTTCCTCCAGCCGTGAGTAT
CGACCGCGTCTGAGGGCCGAACGGTTATTTCTGACCCCCGCGCGCCAGATTCGCGGACACCGTCGGTATCACTTACGGTGACGCCATCCAGTTCGGTGCCGCCGTCGGCCTCTCCCTCTG
CCCCGGCGCCCCGAAGATCCCCGCGTTCGTCGGCCGCAAGAATGCTACGCGCGCCGCGCCCGACAAGACCGTCCCCGAGCCGCAGGACGATCTCACGA
GTGCGCGCGACGCTGACCGGGC
GCGAACTGAGTTGACGCTCGTCCGCAGAGATCTTCGCGCGCATGGACGACGCGGGCTTCAGCCCCTCGGAGCTCATCCACCTGCTTGCATCGCACAGCGTTGCCGACCAGGCCGGCGTAG
ACCCCGAGCCGCAGGTGCTCGGCGCGCCGTTCGACTCGACGCCATTCGAGTTCGACTCGCAGGTCTTCCTCGAGGTCATGCTCCGCGGCACGCTGTTCCCAGGCTCTGGGCCGAACCTCG
GTGCGCCAGCATGCTGTCCACGTGCGGCAGTAGAGTGCGGCTAATGCTGCGTCAGGCGAGGACATGAGCCCGCTGCCGGGTGAATTCCGCTTGCTCTCGGACCGTCTCTTCGCGCGCGAC
AGCCGCACCGCGTGCGCGTGGCAGGAGAATGCTT
GTGCGTCTCTTTTTGTTTTGGCGCGCGTCGTGTGGCCGTGCTGATCCCTGCGATAGTGGACCAGGCCGCGATGGCGCGGAACTTCC
AGGCCGCGTTCACGAAGCTCTCTCTCCTCGGACAGAATAAGAACTCCCTCCTCGACTGCAGCGAAGTCATC
GTGAGTCTTTTCAGTCTCGCATCTTTCGGAATCGCACTGAATCCACTGC
TCAGGCCACCGCGAAGCCCGCACGTGAGAAGCAGGCGCACTTCCCGGCCGGCAAGTCGCACGCCGACATCGAGCAAGGCGTGAGTATCTGCATTTTACAGCACTATGACGTATGAATTGA
CGACTGCCCACCTAGTGCGCCACCAAGCTCTTCCCGACTACGCTCTCGACGCAGGCCGGACGCCCGACAATGATCCCTCCTGTGTAAGTCGCCTTTGTGCGTATGAGCGAAGCATCTGAT
TGACATCCTCGCAGCCAAGTGCAGGACATCCCCTTCGGCAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCCGCGTCCCTCATCACCCTCGCCCTCTCTGGCATCGCAGCGGCCGCACCTGCTGCAACCTGCCCCGATGGCAAGCACACCGCGGTCAACCAGCAGTGCTGCTTCTGGGCCAAT
GTCCGCGACCGGTTCATCAATGAGATTTTCCTCGGAGTGTGCCAAGAGAACGTCCACTCGCTCATCCGGATTGCCTTCCACGACGCGATTGGCTTCTCGCTGCACTCGGAAAAGGGTGGA
GGCGCGGACGGCTCAATGATTCAGTTCGGCGACATCGAGCTCAAGTACC
CCGCGAACGAGGGCATCGACTTCATCACCGCGTTCCTCCAGCCATTCGCGGACACCGTCGGTATCACTTAC
GGTGACGCCATCCAGTTCGGTGCCGCCGTCGGCCTCTCCCTCTGCCCCGGCGCCCCGAAGATCCCCGCGTTCGTCGGCCGCAAGAATGCTACGCGCGCCGCGCCCGACAAGACCGTCCCC
GAGCCGCAGGACGATCTCACGA
AGATCTTCGCGCGCATGGACGACGCGGGCTTCAGCCCCTCGGAGCTCATCCACCTGCTTGCATCGCACAGCGTTGCCGACCAGGCCGGCGTAGACCCC
GAGCCGCAGGTGCTCGGCGCGCCGTTCGACTCGACGCCATTCGAGTTCGACTCGCAGGTCTTCCTCGAGGTCATGCTCCGCGGCACGCTGTTCCCAGGCTCTGGGCCGAACCTCG
GCGAG
GACATGAGCCCGCTGCCGGGTGAATTCCGCTTGCTCTCGGACCGTCTCTTCGCGCGCGACAGCCGCACCGCGTGCGCGTGGCAGGAGAATGCTT
TGGACCAGGCCGCGATGGCGCGGAAC
TTCCAGGCCGCGTTCACGAAGCTCTCTCTCCTCGGACAGAATAAGAACTCCCTCCTCGACTGCAGCGAAGTCATC
GCCACCGCGAAGCCCGCACGTGAGAAGCAGGCGCACTTCCCGGCC
GGCAAGTCGCACGCCGACATCGAGCAAGGC
TGCGCCACCAAGCTCTTCCCGACTACGCTCTCGACGCAGGCCGGACGCCCGACAATGATCCCTCCTGTCCAAGTGCAGGACATCCCCTTC
GGCAAGTAG

Retrieve as FASTA