Entry information : AdelCIIBA06 (GP6)
Entry ID 9717
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2011-11-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2015-02-02 (Christophe Dunand)
Peroxidase information: AdelCIIBA06 (GP6)
Name (synonym) AdelCIIBA06 (GP6)
Class Other class II peroxidase type A    [Orthogroup: CIIBA002]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Auriculariaceae Auricularia
Organism Auricularia delicata    [TaxId: 160860 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value AdelCIIBA06
start..stop
S start..stop
AdelCIIBA05 646 0 1..365 1..362
AdelCIIBA07 615 0 1..366 1..363
AdelCIIBA08 595 0 26..366 23..363
AdelCIIBA10 574 0 26..366 24..364
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 252100..252148 49 N° 2 251986..252047 62 N° 3 251920..251937 18 N° 4 251840..251865 26
N° 5 251647..251789 143 N° 6 251545..251587 43 N° 7 251326..251495 170 N° 8 251062..251274 213
N° 9 250903..251001 99 N° 10 250754..250854 101 N° 11 250630..250704 75 N° 12 250512..250579 68
N° 13 250427..250460 34  
complement(join(250427..250460,250512..250579,250630..250704,250754..250854,2509 03..251001,251062..251274,251326..251495,251545..251587,251647..251789,251840..2 51865,251920..251937,251986..252047,252100..252148))


exon

Literature and cross-references AdelCIIBA06 (GP6)
DNA ref. JGI genome:   scaffold_39 (252148..250427)
Protein sequence: AdelCIIBA06 (GP6)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366 (349)
PWM (Da):   %s   39080.66 (37406.7)  
PI (pH):   %s   5.02 (5.02) Peptide Signal:   %s   cut: 18 range:18-366
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MFATSLIALALSLVATAAPADQLVRCPDGRHTAVNPCCFWANVRDRFINEIFLGVCQENVHSLVRIAFHDAIGFSLHSNKGGGADGSIIQFGDVELKPANEGIDFITAFLKPFADTVGITYGDAIQFGAAVGLSLCPGAPKIPAFVERKNATRAAPDKTVPEPQDDLAIFARMNDAGFSPAELIHLLASHSIADQAGVDPEPQVLGAPFDSTPFLFDSQVFLEVMLRGTLFPGSGPNVGESQSPLAGEFRLQSDQRFARDSRTACTWQEGALDQAAMARNFQSAFTKLSLLGQNQRSLLDCSELATAPPARERQAHFPAGKTHNDIEQACATRAFPATLSTQAGRPTPIPPVQVQDIPFGKK

Retrieve as FASTA  
Remarks Complete sequence from genomic (12 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCTACGTCCCTCATCGCACTAGCCTTATCCTTGGTCGCGACTGGTCTGGTCCATTTCCTGGACGTAGCTTCTAGGTTTCTGACTGGTTGTCCCAGCCGCTCCAGCTGACCAGCT
GGTGAGGTGCCCGGACGGGAGGCACACCGCCGTCAACCCGCAG
GTTTGTCTCCCTGGATCGCTCCGGTTTCGGACTGAGTACCCCCATTAGTGCTGCTTCTGGGCCAACGTAAGCGTCCT
GCCCTGCTCAAAAGTCGTTGAGCTAAATCAATACCGTTGTTAGGTCCGCGACAGATTCATCAACGAGATGTAAGTCCCTCTCTGCTCCCTTCCATGGCGCGAAGCTGACGGAATCACAGT
TTCCTCGGCGTCTGCCAGGAGAATGTTCACTCTCTCGTCCGAATCGCGTTCCACGATGCGATCGGCTTCTCTCTGCACTCCAACAAGGGCGGAGGCGCAGACGGCTCGATCATCCAGTTT
GGAGACGTCGAGCTCAAGTACC
GTACGTTTCCCAACTCGCAGCTCCGTTACACGGTAGCCTGGGAGCTCACGAATTCGCAGCTGCAAACGAGGGCATCGACTTTATCACCGCCTTCCTGA
AGCC
GTCAGTTCCCTTGCTTTCCATTGAGCAGGTCCTTCTAACTGACGTGCAGCTTCGCGGACACGGTCGGCATCACTTACGGTGACGCCATTCAATTCGGCGCCGCCGTCGGCCTTTCG
CTCTGCCCCGGTGCTCCAAAGATTCCCGCCTTCGTCGAACGCAAGAACGCTACGCGCGCCGCGCCCGACAAGACCGTCCCCGAGCCGCAGGACGACCTCACGG
GTCAGAGAACCCCCGAG
TCTGTCTGACATTCGATCTCATGGTTCATCTTAGCCATCTTCGCGCGCATGAACGACGCTGGATTCAGTCCTGCTGAACTGATCCACCTGCTCGCCTCTCACAGTATTGCTGACCAGGCC
GGTGTCGATCCCGAGCCGCAGGTGCTGGGCGCACCCTTCGACTCGACGCCGTTCCTATTCGACTCCCAGGTCTTCCTCGAGGTCATGCTGCGCGGCACGCTCTTCCCCGGTTCGGGTCCC
AACGTTG
GTACGCCGCAACCCCATTCGTCACGCCACGCGTACGAGTCTGACACATCGACTCTCGAAGGCGAGTCACAGAGCCCGCTCGCGGGAGAGTTCCGCTTGCAATCCGACCAGCGC
TTCGCGCGCGACAGTCGGACCGCGTGCACGTGGCAGGAAGGCGCTC
GTATGTGCCTTCGTCGCATTTCCATCTTCCTGACTCATCCCGGGTCAGTCGACCAGGCTGCGATGGCGCGCAAC
TTCCAGTCGGCGTTCACCAAGCTCTCGCTCCTCGGCCAGAACCAGCGCTCCCTCCTCGACTGTAGTGAACTCATT
GTGCGTTATCGCGGGCTCCTCTTACTCGCTCGGCTGATATGAAGG
CCAGGCCACTGCGCCTCCCGCGCGTGAGAGACAGGCTCACTTCCCTGCTGGGAAAACGCACAACGATATCGAGCAGGCGGTACGTCATTCCTTCCATTTCGCCAGCAAGGCTGAATGCGG
TCATCCCAGTGTGCCACGCGCGCGTTCCCAGCCACGCTGTCGACCCAGGCCGGACGCCCCACTCCTATTCCTCCTGTGTAAGTTCATCCTACCGCGCGCTGGATTGAGACCTCTTACAGT
GATCACAGGCAAGTACAGGATATCCCATTCGGGAAGAAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTTCGCTACGTCCCTCATCGCACTAGCCTTATCCTTGGTCGCGACTGCCGCTCCAGCTGACCAGCTGGTGAGGTGCCCGGACGGGAGGCACACCGCCGTCAACCCGCAGTGCTGCTTC
TGGGCCAAC
GTCCGCGACAGATTCATCAACGAGATTTTCCTCGGCGTCTGCCAGGAGAATGTTCACTCTCTCGTCCGAATCGCGTTCCACGATGCGATCGGCTTCTCTCTGCACTCCAAC
AAGGGCGGAGGCGCAGACGGCTCGATCATCCAGTTTGGAGACGTCGAGCTCAAGTACC
CTGCAAACGAGGGCATCGACTTTATCACCGCCTTCCTGAAGCCCTTCGCGGACACGGTCGGC
ATCACTTACGGTGACGCCATTCAATTCGGCGCCGCCGTCGGCCTTTCGCTCTGCCCCGGTGCTCCAAAGATTCCCGCCTTCGTCGAACGCAAGAACGCTACGCGCGCCGCGCCCGACAAG
ACCGTCCCCGAGCCGCAGGACGACCTCACGG
CCATCTTCGCGCGCATGAACGACGCTGGATTCAGTCCTGCTGAACTGATCCACCTGCTCGCCTCTCACAGTATTGCTGACCAGGCCGGT
GTCGATCCCGAGCCGCAGGTGCTGGGCGCACCCTTCGACTCGACGCCGTTCCTATTCGACTCCCAGGTCTTCCTCGAGGTCATGCTGCGCGGCACGCTCTTCCCCGGTTCGGGTCCCAAC
GTTG
GCGAGTCACAGAGCCCGCTCGCGGGAGAGTTCCGCTTGCAATCCGACCAGCGCTTCGCGCGCGACAGTCGGACCGCGTGCACGTGGCAGGAAGGCGCTCTCGACCAGGCTGCGATG
GCGCGCAACTTCCAGTCGGCGTTCACCAAGCTCTCGCTCCTCGGCCAGAACCAGCGCTCCCTCCTCGACTGTAGTGAACTCATT
GCCACTGCGCCTCCCGCGCGTGAGAGACAGGCTCAC
TTCCCTGCTGGGAAAACGCACAACGATATCGAGCAGGCG
TGTGCCACGCGCGCGTTCCCAGCCACGCTGTCGACCCAGGCCGGACGCCCCACTCCTATTCCTCCTGTGCAAGTACAGGAT
ATCCCATTCGGGAAGAAGTAA

Retrieve as FASTA