Entry information : BaCIIBB03
Entry ID 9728
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2011-11-17 (Christophe Dunand)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-03-01 (Christophe Dunand)
Peroxidase information: BaCIIBB03
Name BaCIIBB03
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaCIIBB03
start..stop
S start..stop
HanCIIBB07 572 0 8..364 5..361
PstrCIIBB02 553 0 1..364 1..359
HanCIIBB02 552 0 1..364 1..356
SsteCIIBB02 538 0 6..353 3..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 457074..457134 61 N° 2 457190..457340 151 N° 3 457393..457412 20 N° 4 457466..457637 172
N° 5 457692..457889 198 N° 6 457942..458183 242 N° 7 458259..458496 238 N° 8 458555..458567 13
join(457074..457134,457190..457340,457393..457412,457466..457637,457692..457889, 457942..458183,458259..458496,458555..458567)


exon

Literature and cross-references BaCIIBB03
DNA ref. JGI genome:   scaffold_25 (457074..458567)
Protein sequence: BaCIIBB03
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   364 (343)
PWM (Da):   %s   37934.88 (35801.7)  
PI (pH):   %s   4.35 (4.30) Peptide Signal:   %s   cut: 22 range:22-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFGKFAILLATVTLSQVANGALTRRVTCPDGKNTASNAACCALFAVRDDIQANLFDGGECGEEVHESLRLTFHDAGFSPSLTAQGKFGGGGADGSLIAFSDVETLFHANGGIDEIVEVQKPFVAQHNMTPGDFIQFAGAIGVSNCPGAPRLEFLLGRPAPTAPAPDLTVPEPFDTVDSILARFDDVGISPAEVVALLASHSVAAADHVDPSIPGTPFDSTPSTFDTQLFVEVQLRGTLFPGTGGNQGEVESALRGEIRLQSDHVVARDSRTACEWQSFNNQQKLQTAFRAAMAKLAILGHDRADMIDCSEVIPVPKAFTKAATFPAGITINDVEQACADAPFPTLSTDPGPATSVPPVPAS

Retrieve as FASTA  
Remarks Complete sequence from genomic (7 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTCGGCAAATTTGCTATTCTTCTTGCCACCGTTACCCTTTCACAGGTCGCAAATGGTGCGCTTTCACTTTCTATGTTTTTTTCGCTCTCGTACTCATCCCCTCTATCCAGGCGC
CCTCACCCGCCGTGTGACGTGCCCCGACGGCAAGAATACCGCGTCCAACGCGGCCTGCTGCGCGCTGTTCGCTGTTCGTGATGACATTCAGGCCAATCTGTTCGACGGAGGCGAGTGTGG
CGAAGAGGTCCACGAATCCCTTCGATT
GTAGGCCACTCTCCTTCATTGTTACTGTGCATTGCTAACCTGCTTTTTTTAGGACTTTCCACGACGCCATTGGTACATTCTTCGTTTTCCATT
TTGAGCCTTTCACAACACTGACCAATCACCAGGCTTCTCTCCGTCTCTCACGGCTCAGGGCAAGTTCGGTGGTGGTGGAGCCGACGGCTCTCTCATCGCCTTCAGCGATGTTGAGACCCT
CTTCCACGCCAACGGCGGCATCGACGAGATTGTCGAGGTCCAGAAGCCCTTCGTGGCGCAACACAACATGACGCCCGGTGATTT
GTACGTCTGCATCACATTCCTAAACGTTACTTCATA
ACTCATTACCAAATCCAGCATCCAATTCGCTGGCGCCATCGGTGTGAGCAACTGCCCTGGCGCGCCTCGTCTCGAGTTCCTGCTTGGCAGGCCGGCTCCGACTGCCCCGGCGCCTGACCT
GACGGTCCCGGAGCCGTTCGACACTGTCGACAGCATCCTCGCGCGCTTTGATGATGTCGGTATCTCGCCCGCGGAGGTCGTTGCCCTTCTCGCGTC
GTATGTTGTGTCCCTCTCACTCGT
GTTGCCTCCACTGATCCCATTACCCCAGGCACTCGGTCGCTGCAGCCGACCACGTCGACCCCAGCATCCCCGGCACGCCCTTCGACTCGACACCCAGCACCTTCGACACCCAGCTCTTCG
TCGAGGTCCAACTGCGCGGCACGCTCTTCCCCGGCACGGGCGGAAACCAGGGCGAAGTCGAATCGGCGCTCCGCGGCGAGATCCGTCTTCAGTCCGACCACGTCGTTGCACGCGACTCCC
GCACCGCCTGCGAGTGGCAATCCTTCGTTA
GTACGTATGCGGCCCCGCCTCCGCTTCCGCCTTTGGATCAATTCCGCAGCATGCTGATGCGCCGCCCCGTTTCAGACAACCAGCAGAAGC
TGCAGACCGCCTTCCGCGCTGCGATGGCCAAGCTTGCTATCCTCGGACACGACAGGGCAGACATGATTGACTGCTCTGAGGTCATCCCCGTCCCGAAGGCGTTCACCAAGGCTGCGACTT
TCCCCGCTGGCATCACCATCAACGACGTCGAGCAGGCCTGTGCGGACGCGCCGTTCCCCACCCTCTCAACCGACCCCGGCCCGGCGACCTCTGTTCCCCCCGT
GTAAGTCGTTCAGTCTT
GTCTAACGACGGTTCGAGTTACTGATCTATCTCCTCTATAGTCCCGCTTCATAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCATTCGGCAAATTTGCTATTCTTCTTGCCACCGTTACCCTTTCACAGGTCGCAAATGGCGCCCTCACCCGCCGTGTGACGTGCCCCGACGGCAAGAATACCGCGTCCAACGCGGCC
TGCTGCGCGCTGTTCGCTGTTCGTGATGACATTCAGGCCAATCTGTTCGACGGAGGCGAGTGTGGCGAAGAGGTCCACGAATCCCTTCGATT
GACTTTCCACGACGCCATTGGCTTCTCT
CCGTCTCTCACGGCTCAGGGCAAGTTCGGTGGTGGTGGAGCCGACGGCTCTCTCATCGCCTTCAGCGATGTTGAGACCCTCTTCCACGCCAACGGCGGCATCGACGAGATTGTCGAGGTC
CAGAAGCCCTTCGTGGCGCAACACAACATGACGCCCGGTGATTT
CATCCAATTCGCTGGCGCCATCGGTGTGAGCAACTGCCCTGGCGCGCCTCGTCTCGAGTTCCTGCTTGGCAGGCCG
GCTCCGACTGCCCCGGCGCCTGACCTGACGGTCCCGGAGCCGTTCGACACTGTCGACAGCATCCTCGCGCGCTTTGATGATGTCGGTATCTCGCCCGCGGAGGTCGTTGCCCTTCTCGCG
TC
GCACTCGGTCGCTGCAGCCGACCACGTCGACCCCAGCATCCCCGGCACGCCCTTCGACTCGACACCCAGCACCTTCGACACCCAGCTCTTCGTCGAGGTCCAACTGCGCGGCACGCTC
TTCCCCGGCACGGGCGGAAACCAGGGCGAAGTCGAATCGGCGCTCCGCGGCGAGATCCGTCTTCAGTCCGACCACGTCGTTGCACGCGACTCCCGCACCGCCTGCGAGTGGCAATCCTTC
GTTA
ACAACCAGCAGAAGCTGCAGACCGCCTTCCGCGCTGCGATGGCCAAGCTTGCTATCCTCGGACACGACAGGGCAGACATGATTGACTGCTCTGAGGTCATCCCCGTCCCGAAGGCG
TTCACCAAGGCTGCGACTTTCCCCGCTGGCATCACCATCAACGACGTCGAGCAGGCCTGTGCGGACGCGCCGTTCCCCACCCTCTCAACCGACCCCGGCCCGGCGACCTCTGTTCCCCCC
GT
TCCCGCTTCATAA

Retrieve as FASTA