Entry information : BaCIIBA04
Entry ID 9730
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2011-11-17 (Christophe Dunand)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2012-08-31 (Nizar Fawal)
Peroxidase information: BaCIIBA04
Name BaCIIBA04
Class Other class II peroxidase type A    [Orthogroup: CIIBA001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaCIIBA04
start..stop
S start..stop
CuniCIIBA04 566 0 1..362 1..363
CuniCIIBA01 545 0 1..359 1..358
ParcCIIBA04 522 0 20..359 21..361
HanCIIBA 519 0 1..362 1..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 332955..333068 114 N° 2 333121..333201 81 N° 3 333254..333267 14 N° 4 333330..333383 54
N° 5 333436..333449 14 N° 6 333499..333540 42 N° 7 333594..333672 79 N° 8 333728..333968 241
N° 9 334027..334225 199 N° 10 334278..334450 173 N° 11 334510..334574 65 N° 12 334627..334639 13
join(332955..333068,333121..333201,333254..333267,333330..333383,333436..333449, 333499..333540,333594..333672,333728..333968,334027..334225,334278..334450,33451 0..334574,334627..334639)


exon

Literature and cross-references BaCIIBA04
DNA ref. JGI genome:   scaffold_19 (332955..334639)
Protein sequence: BaCIIBA04
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (344)
PWM (Da):   %s   38213.92 (36320.9)  
PI (pH):   %s   4.7 (4.63) Peptide Signal:   %s   cut: 19 range:19-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKNIFVFVALATAVVAAPGSEKRVDCGGGRTASDAVCCKWFTVLDDIQTNLFDGGECGEETHESLRLTFHDAIGFSLSAERAGKFGGGGDGSMMAFAEIETNFHANNGVDDIVEVQRPFALKHGVSFGDFIQFAGAVGVSNCVGGPRLQFKAGRSNISRPAPDLTVPEPFDSTDKIFARMGDAGFSPNEVVDLLASHTVAAQDHVDATIGTPFDSTPSTFDSQFFLETLLKGTLFPGNGPNQGEVLSPLHGELRLQSDFEISQDPRTACEWQSFLTNHDLMVSRFERVMSKLAVLGQNPNRLVDCSEVIPVPKGRVGAAVIPAGKTQADIQGCRATPVPRLSAAPGPETSVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns). Predict of the last intron need to be controled (look for EST).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAACATCTTCGTTTTCGTCGCTCTCGCCACTGCTGTCGTCGCAGCCCCAGGCTCCGAAAAGCGAGTCGACTGCGGTGGCGGACGCACTGCGAGCGACGCAGTTGTACGT
TTTACTAGAACTTTACCCGCCGTGCAGTACTCACCTCGTGTCGTAGTGTTGCAAATGGTTCACCGTTCTGGACGACATCCAGACCAACCTTTTCGATGGCGGCGAGTGCGGTGAGGAAAC
TCACGAG
GTAAGCCTACCCTAGATACGTGTTGTATCTTGGCCTGACGTCTCACACACAGTCTCTGCGTCTGACGTGAGTTGGACACTCGGTTGTCAAGCTCTGACATTTGTTCAATCATT
TATGGCGATTCCTAGTTTCCACGACGCTATTGGTTTCAGTCTTTCGGCTGAACGTGCTGGCAAATTCGGGTATGTGATCGCTACTAAAAAACACGCACATCTGTCTGACTCTCACTTCCA
GCGGCGGAGGAGCAGGTAAGCTCGGAGCAGAACCTCCATTAAGTATACGCTCATGATTGTCTAGATGGTTCCATGATGGCTTTCGCCGAAATTGAGACCAACTTCCGTGAGTAGCAAAGC
TGATTCTACTCCAAAAGAACGTACTCAATTTGCATACAGATGCCAACAACGGTGTAGACGATATCGTTGAAGTACAGCGTCCCTTTGCGCTCAAGCACGGCGTGTCTTTCGGCGACTTGT
GCGTAATGATCCATATTGGTTTCAAGACCATCCGAACTTCATCTCTGTAATAGCATCCAATTCGCGGGCGCTGTCGGTGTTTCCAACTGTGTCGGTGGACCGCGCCTCCAGTTCAAGGCC
GGCCGTTCCAACATCTCGCGCCCTGCTCCCGACCTGACCGTCCCGGAGCCCTTCGACAGTACTGACAAGATCTTCGCCCGCATGGGTGATGCTGGGTTCTCCCCGAACGAGGTCGTCGAT
CTTCTGGCTTCCCACACTGTTGCTGCTCAGGACCATGTCGACGCGACTATTCCC
GTACGTCAGCGCCTGAATCGTATCGTATCTTTCGCTCTGACCAAGCATCATTATACAGGGAACCCC
CTTCGACTCGACTCCCAGTACTTTCGATAGCCAGTTCTTCCTCGAGACACTCTTGAAGGGCACCCTCTTCCCCGGCAACGGTCCCAACCAGGGCGAGGTTCTGTCTCCTCTCCACGGCGA
GCTCCGCCTCCAGTCCGACTTCGAGATCTCCCAGGACCCGAGGACCGCCTGCGAGTGGCAATCCTTCCTCA
GTACGATATCTTACCTCGCATCCCGCAACCACTAAACTGACGTATGCAC
TAGCCAACCACGATTTGATGGTCTCCCGCTTCGAGCGTGTCATGTCCAAGCTCGCTGTCCTTGGCCAGAACCCCAATAGGCTTGTTGACTGCTCTGAGGTCATTCCCGTCCCCAAGGGCC
GTGTCGGTGCTGCCGTCATCCCCGCTGGAAAGACCCAGGCCGATATCCAGGGTGCC
GTGAGCAGCTCTCTTAGCTTGCCGTGCCATATAATCGACTAATGCTTCATGAAATCTAGTGCCG
TGCCACCCCCGTCCCCCGCCTCTCCGCTGCCCCCGGTCCCGAGACTTCGGTCGCTCCCGT
GTACGTGTCTGTCCTATCCCACTGTCCCCCCTTGATTCTGACGAGCTCGCAGCCCCCCGT
CTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAGAACATCTTCGTTTTCGTCGCTCTCGCCACTGCTGTCGTCGCAGCCCCAGGCTCCGAAAAGCGAGTCGACTGCGGTGGCGGACGCACTGCGAGCGACGCAGTTTGTTGC
AAATGGTTCACCGTTCTGGACGACATCCAGACCAACCTTTTCGATGGCGGCGAGTGCGGTGAGGAAACTCACGAG
TCTCTGCGTCTGACTTTCCACGACGCTATTGGTTTCAGTCTTTCG
GCTGAACGTGCTGGCAAATTCGG
CGGCGGAGGAGCAGATGGTTCCATGATGGCTTTCGCCGAAATTGAGACCAACTTCCATGCCAACAACGGTGTAGACGATATCGTTGAAGTACAGCGT
CCCTTTGCGCTCAAGCACGGCGTGTCTTTCGGCGACTT
CATCCAATTCGCGGGCGCTGTCGGTGTTTCCAACTGTGTCGGTGGACCGCGCCTCCAGTTCAAGGCCGGCCGTTCCAACATC
TCGCGCCCTGCTCCCGACCTGACCGTCCCGGAGCCCTTCGACAGTACTGACAAGATCTTCGCCCGCATGGGTGATGCTGGGTTCTCCCCGAACGAGGTCGTCGATCTTCTGGCTTCCCAC
ACTGTTGCTGCTCAGGACCATGTCGACGCGACTATTCCC
GGAACCCCCTTCGACTCGACTCCCAGTACTTTCGATAGCCAGTTCTTCCTCGAGACACTCTTGAAGGGCACCCTCTTCCCC
GGCAACGGTCCCAACCAGGGCGAGGTTCTGTCTCCTCTCCACGGCGAGCTCCGCCTCCAGTCCGACTTCGAGATCTCCCAGGACCCGAGGACCGCCTGCGAGTGGCAATCCTTCCTCA
CC
AACCACGATTTGATGGTCTCCCGCTTCGAGCGTGTCATGTCCAAGCTCGCTGTCCTTGGCCAGAACCCCAATAGGCTTGTTGACTGCTCTGAGGTCATTCCCGTCCCCAAGGGCCGTGTC
GGTGCTGCCGTCATCCCCGCTGGAAAGACCCAGGCCGATATCCAGGGTGCC
TGCCGTGCCACCCCCGTCCCCCGCCTCTCCGCTGCCCCCGGTCCCGAGACTTCGGTCGCTCCCGTCCCC
CCGTCTTAA

Retrieve as FASTA