Entry information : BaCIIBB06
Entry ID 9736
Creation 2011-11-17 (Christophe Dunand)
Last sequence changes 2011-11-17 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2012-03-01 (Catherine Mathe)
Peroxidase information: BaCIIBB06
Name BaCIIBB06
Class Other class II peroxidase type B    [Orthogroup: CIIBB001]
Taxonomy Eukaryota Fungi Basidiomycota Agaricomycetes Meruliaceae Bjerkandera
Organism Bjerkandera adusta    [TaxId: 5331 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value BaCIIBB06
start..stop
S start..stop
BaCIIBB02 572 0 1..355 1..355
TvCIIBB02_IFO30340 561 0 1..366 1..365
TvCIIBB02_PRL572 560 0 1..366 1..365
TvCIIBB02 560 0 1..366 1..365
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 442983..443043 61 N° 2 443095..443245 151 N° 3 443307..443363 57 N° 4 443415..443549 135
N° 5 443605..443684 80 N° 6 443742..443783 42 N° 7 443835..443913 79 N° 8 443970..444095 126
N° 9 444148..444263 116 N° 10 444323..444498 176 N° 11 444559..444623 65 N° 12 444683..444695 13
join(442983..443043,443095..443245,443307..443363,443415..443549,443605..443684, 443742..443783,443835..443913,443970..444095,444148..444263,444323..444498,44455 9..444623,444683..444695)


exon

Literature and cross-references BaCIIBB06
DNA ref. JGI genome:   scaffold_24 (442983..444695)
Protein sequence: BaCIIBB06
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   366 (345)
PWM (Da):   %s   38408.84 (36157.7)  
PI (pH):   %s   4.12 (4.11) Peptide Signal:   %s   cut: 22 range:22-366
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFKQLCASLLFALSLQTVEGALTRRVACPDGVNTATNAACCSLFAIRDDLQKNLFDNGGCGEDVHESLRLTFHDAIGISPKIAASGQFGGGGADGSIALFEDIETNFHANLGVDEIINEQKPILARHNISTGDFIQFAGAVGVSNCPGAPRVQFMFGRTATQPAPDLTVPEPFDTVDSIIERFADAGGFTPEEIVALLVSHTIAAADHVDPSIPGTPFDSTPSTFDSQFFVETQLRGVIFPGTGGNQGEVESPLEGEIRLLSDSELARDSRTACEWQSFNNQDKIKSAFAAAFAKMTTLGNDVNQMVDCSEVLPIPPDTVIPPAHLPAGKTMNDIEQCATAPFPSLSADPGPATSVAPVPPS

Retrieve as FASTA  
Remarks Complete sequence from genomic (11 introns).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAACAACTCTGCGCCTCGCTTCTGTTCGCCCTCTCTCTTCAAACTGTTGAGGGTAAGTTATCATCGCGGACATCTTCGAAAACATTTGCTGATTATCACGCAGGGGCTCTG
ACCCGCCGTGTCGCCTGTCCCGATGGGGTGAACACAGCGACCAACGCAGCTTGCTGCTCTTTGTTTGCTATCCGTGACGACCTTCAGAAAAACCTCTTTGATAATGGTGGATGCGGTGAA
GACGTCCACGAATCACTTCGTCT
GTACGTCTTATTTTTCCATTTCGGTGTCATGATTGTCTCACGTCGGGTTTTTTGATGACAGGACATTCCACGACGCTATCGGTATCTCGCCTAAGAT
AGCCGCCAGTGGGCAGTTTGG
GTACGTCCAACATTCATCGTGCAGCAGAAGAATATTAATCCGTATTTCCAGTGGTGGTGGTGCTGACGGCTCCATCGCTCTCTTCGAAGATATAGAGAC
AAACTTCCACGCCAACTTGGGTGTCGATGAAATCATCAACGAGCAGAAGCCTATATTGGCGAGACACAACATCTCTACCGGCGACTT
GTACGTTTCGATCATCGCACTTTGGTATCTAAT
GATACTCAAACTGTTCGTTCAGTATCCAGTTCGCTGGTGCAGTTGGTGTGAGCAACTGTCCTGGTGCTCCCCGCGTCCAGTTCATGTTTGGTCGTACCGATGGTGCGGCTCGTGTCAGTC
CATCAGTGTGACAGCCACTGACTTGGACATGTGAAACAGCGACTCAACCTGCGCCAGACTTGACTGTCCCCGAGCCCTTCGGCGAGTAACACAGTTTAACACGCCAACCTGTTGCTTACT
CTATTTCTTTAGACACTGTGGACTCCATCATAGAGCGGTTCGCTGACGCTGGCGGCTTCACACCGGAGGAGATCGTTGCCCTTCTCGTCTCGTAAGGATATTTCGTACTGTCAAATGCAT
CCCAGCTGATTCACACCATTTGTGCAGCCACACAATTGCTGCTGCCGACCATGTCGATCCCAGCATCCCTGGAACGCCGTTCGACTCGACTCCCAGTACATTCGACTCGCAGTTCTTCGT
GGAGACCCAACTTCGGGGTGTCATTTTCCCCGG
GTAAGTACACGCCATTCTAAAGCTCTTGTATTAGCCTTGACGTTCGCTGCAGTACGGGGGGCAACCAAGGCGAGGTCGAGTCCCCTC
TTGAGGGAGAGATCCGCCTGCTATCCGACTCCGAACTTGCACGTGACTCCCGCACAGCGTGCGAGTGGCAGTCGTTCGTCA
GTGCGTATCCCACATTAAACTCCATGTTCCTCGTGTTCT
GATTAAAGAGGGCCTTGTAGACAACCAAGACAAGATCAAGAGCGCGTTTGCGGCGGCGTTTGCCAAGATGACTACCCTCGGGAACGACGTGAACCAAATGGTCGACTGCTCTGAGGTGCT
GCCCATTCCGCCCGACACCGTCATCCCACCTGCCCACCTCCCCGCGGGAAAGACGATGAACGACATTGAGCAAGCT
GTGAGTACTCTATCTCGTGCCTTTTCTAAATCCATGTAGCTGAC
AAAGCCCAATGAATAGTGCGCTACCGCTCCGTTCCCGTCTCTCTCTGCCGACCCTGGCCCCGCCACCTCTGTCGCGCCTGTGTGAGTATCGTCTCGCTTAACGACTCTGAGACTCTTGCT
GACGTGGTATTTTTGTACAGCCCGCCGTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCAAACAACTCTGCGCCTCGCTTCTGTTCGCCCTCTCTCTTCAAACTGTTGAGGGGGCTCTGACCCGCCGTGTCGCCTGTCCCGATGGGGTGAACACAGCGACCAACGCAGCT
TGCTGCTCTTTGTTTGCTATCCGTGACGACCTTCAGAAAAACCTCTTTGATAATGGTGGATGCGGTGAAGACGTCCACGAATCACTTCGTCT
GACATTCCACGACGCTATCGGTATCTCG
CCTAAGATAGCCGCCAGTGGGCAGTTTGG
TGGTGGTGGTGCTGACGGCTCCATCGCTCTCTTCGAAGATATAGAGACAAACTTCCACGCCAACTTGGGTGTCGATGAAATCATCAACGAG
CAGAAGCCTATATTGGCGAGACACAACATCTCTACCGGCGACTT
TATCCAGTTCGCTGGTGCAGTTGGTGTGAGCAACTGTCCTGGTGCTCCCCGCGTCCAGTTCATGTTTGGTCGTACC
GATG
CGACTCAACCTGCGCCAGACTTGACTGTCCCCGAGCCCTTCGACACTGTGGACTCCATCATAGAGCGGTTCGCTGACGCTGGCGGCTTCACACCGGAGGAGATCGTTGCCCTTCTC
GTCTC
CCACACAATTGCTGCTGCCGACCATGTCGATCCCAGCATCCCTGGAACGCCGTTCGACTCGACTCCCAGTACATTCGACTCGCAGTTCTTCGTGGAGACCCAACTTCGGGGTGTC
ATTTTCCCCGG
TACGGGGGGCAACCAAGGCGAGGTCGAGTCCCCTCTTGAGGGAGAGATCCGCCTGCTATCCGACTCCGAACTTGCACGTGACTCCCGCACAGCGTGCGAGTGGCAGTCG
TTCGTCA
ACAACCAAGACAAGATCAAGAGCGCGTTTGCGGCGGCGTTTGCCAAGATGACTACCCTCGGGAACGACGTGAACCAAATGGTCGACTGCTCTGAGGTGCTGCCCATTCCGCCC
GACACCGTCATCCCACCTGCCCACCTCCCCGCGGGAAAGACGATGAACGACATTGAGCAAGCT
TGCGCTACCGCTCCGTTCCCGTCTCTCTCTGCCGACCCTGGCCCCGCCACCTCTGTC
GCGCCTGT
CCCGCCGTCGTAA

Retrieve as FASTA