Entry information : TsPrx70 (Thhalv10004567m)
Entry ID 9753
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-17 (Christophe Dunand)
Peroxidase information: TsPrx70 (Thhalv10004567m)
Name (synonym) TsPrx70 (Thhalv10004567m)
Class Class III peroxidase    [Orthogroup: Prx087]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx70
start..stop
S start..stop
BrPrx70-1Aa_other 598 0 1..331 1..333
BstrPrx73 597 0 1..331 1..331
AlyPrx70 580 0 1..331 1..332
CrubPrx81 579 0 1..331 1..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1394332..1394751 420 N° 2 1394863..1395022 160 N° 3 1395456..1395874 419  
join(1394332..1394751,1394863..1395022,1395456..1395874)


exon

Literature and cross-references TsPrx70 (Thhalv10004567m)
DNA ref. Phytozome 12:   scaffold_6 (1394332..1395874)
Protein sequence: TsPrx70 (Thhalv10004567m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (302)
PWM (Da):   %s   36224.61 (33047.8)  
PI (pH):   %s   7.68 (6.74) Peptide Signal:   %s   cut: 31 range:31-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGSVTSLNPRYVLLPLLLVLAATATTKANAFLPRPRIGYYGSACWNVESIVRSVVQSNFITNPANAPGILRMHFHDCFVQGCDGSVLLDGPNSERTAIPNLSLRGFNVIEEAKTQLEIACPRTVSCADILALAARDFVVLTGGPWWPVPLGRLDGRVSLASNVDLPEPTDSVEVQKQRFAAKNLNTQDLVVLAAGHTIGTVGCGVFRDRFFNYNNTGSPDPTINPSFIPQIQSQCPLNGNPATRVALDTGSEGQFDTSYLNNLRFGRGVLESDQVLWNNPETRPIVERLLGIRFPFLLFGPEFARSMYKMSLIQVKTGLDGEIRRVCSAVNP*

Retrieve as FASTA  
Remarks Complete sequence fromm genomic. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGTGTTACTAGTTTGAATCCCCGCTACGTTCTATTACCGTTACTCCTTGTCCTAGCCGCAACTGCAACCACAAAGGCGAACGCATTCCTCCCGAGGCCACGGATCGGGTATTAC
GGTAGTGCATGCTGGAATGTAGAATCGATAGTGCGGTCCGTTGTACAGTCTAACTTTATTACAAATCCAGCCAATGCACCGGGCATTTTGCGTATGCATTTTCATGATTGTTTCGTTCAA
GGCTGCGACGGGTCCGTTCTCCTGGACGGACCTAACTCTGAGAGAACCGCGATTCCGAATCTATCGCTGAGAGGGTTTAATGTCATCGAAGAAGCTAAAACTCAGCTTGAGATCGCTTGT
CCTCGAACAGTCTCTTGTGCTGATATTCTCGCGCTAGCTGCACGTGACTTCGTCGTTCTG
GTATAACCTATACTCTTTTTATTTTTTTTTATTATTATTTTTTTGTTGTAAGTCTATTTA
TTGATTTTAAATTTACGTAATTAAATGGAAGTTTAATATACGCATATATAGACCGGTGGACCATGGTGGCCAGTTCCATTGGGACGACTCGATGGCCGGGTTTCACTAGCCTCGAATGTC
GATCTGCCTGAACCTACCGACTCCGTTGAGGTGCAGAAGCAGAGGTTCGCCGCAAAAAATCTTAACACCCAAGATCTCGTTGTCCTTGCTG
GTACGTAAATCAATTTAGATTTAAGCATC
GATTTTTACTACCATAGCTCATTTGCCATTTTGTTTTTATATGTGAACTTTTTTTCTTAGAAATTTCTGCAAAATATACACGTGAATAACAAACACATACTAGTTGTTTACGTCTATACA
ATTTCATGAACAAGTTTTGGTGTAATTTTTGAATTTTTAAAAATCAATGAATTTTGAATATGTACACTCATGAAAGTAGAAATTTCTTTATTAAATTATTTTTTTCTTTCAAACTTTCAG
AAATAAAAAAAAACTCCGAATATAACTTTACCAAACGTGTGTCAATTGATCTATCGTAGCATGGTATAGATTTCTTGCTTCCTTTCAATATATTACAAATTACATCACTTGAAATGATCT
CGAGTTGCCTTGTAATTGACATAGAGGGTTTTGGTATATAACAGCCGGACACACGATAGGAACGGTCGGGTGTGGTGTGTTTAGAGACAGGTTCTTCAACTACAACAACACTGGAAGTCC
TGACCCAACCATAAACCCAAGTTTCATCCCTCAGATCCAATCTCAGTGTCCTCTCAACGGCAACCCCGCTACTCGTGTCGCGCTGGACACGGGAAGTGAAGGCCAGTTCGACACTTCGTA
CCTCAACAACTTGAGGTTTGGTCGAGGTGTCCTCGAGTCTGATCAGGTCCTATGGAATAACCCCGAGACTCGGCCCATCGTGGAAAGGTTGTTAGGAATACGGTTTCCGTTTCTGTTGTT
CGGACCCGAGTTTGCTAGGTCGATGTATAAGATGAGTCTGATTCAGGTCAAGACGGGTTTGGATGGGGAGATTCGTAGGGTTTGTTCTGCGGTTAATCCTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAAGTGTTACTAGTTTGAATCCCCGCTACGTTCTATTACCGTTACTCCTTGTCCTAGCCGCAACTGCAACCACAAAGGCGAACGCATTCCTCCCGAGGCCACGGATCGGGTATTAC
GGTAGTGCATGCTGGAATGTAGAATCGATAGTGCGGTCCGTTGTACAGTCTAACTTTATTACAAATCCAGCCAATGCACCGGGCATTTTGCGTATGCATTTTCATGATTGTTTCGTTCAA
GGCTGCGACGGGTCCGTTCTCCTGGACGGACCTAACTCTGAGAGAACCGCGATTCCGAATCTATCGCTGAGAGGGTTTAATGTCATCGAAGAAGCTAAAACTCAGCTTGAGATCGCTTGT
CCTCGAACAGTCTCTTGTGCTGATATTCTCGCGCTAGCTGCACGTGACTTCGTCGTTCTG
ACCGGTGGACCATGGTGGCCAGTTCCATTGGGACGACTCGATGGCCGGGTTTCACTAGCC
TCGAATGTCGATCTGCCTGAACCTACCGACTCCGTTGAGGTGCAGAAGCAGAGGTTCGCCGCAAAAAATCTTAACACCCAAGATCTCGTTGTCCTTGCTG
CCGGACACACGATAGGAACG
GTCGGGTGTGGTGTGTTTAGAGACAGGTTCTTCAACTACAACAACACTGGAAGTCCTGACCCAACCATAAACCCAAGTTTCATCCCTCAGATCCAATCTCAGTGTCCTCTCAACGGCAAC
CCCGCTACTCGTGTCGCGCTGGACACGGGAAGTGAAGGCCAGTTCGACACTTCGTACCTCAACAACTTGAGGTTTGGTCGAGGTGTCCTCGAGTCTGATCAGGTCCTATGGAATAACCCC
GAGACTCGGCCCATCGTGGAAAGGTTGTTAGGAATACGGTTTCCGTTTCTGTTGTTCGGACCCGAGTTTGCTAGGTCGATGTATAAGATGAGTCTGATTCAGGTCAAGACGGGTTTGGAT
GGGGAGATTCGTAGGGTTTGTTCTGCGGTTAATCCTTAA

Retrieve as FASTA