Entry information : TsPrx71 (Thhalv10004581m)
Entry ID 9755
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-17 (Christophe Dunand)
Peroxidase information: TsPrx71 (Thhalv10004581m)
Name (synonym) TsPrx71 (Thhalv10004581m)
Class Class III peroxidase    [Orthogroup: Prx006]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx71
start..stop
S start..stop
BnPrx71-1Ca_other 608 0 1..327 1..328
BrPrx71-1Aa_other 607 0 1..327 1..328
CagraPrx67 597 0 1..327 1..328
CrubPrx67 597 0 1..327 1..328
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1389622..1390038 417 N° 2 1390130..1390292 163 N° 3 1390564..1390967 404  
join(1389622..1390038,1390130..1390292,1390564..1390967)


exon

Literature and cross-references TsPrx71 (Thhalv10004581m)
DNA ref. Phytozome 12:   scaffold_6 (1389622..1390967)
Protein sequence: TsPrx71 (Thhalv10004581m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (304)
PWM (Da):   %s   34624.47 (32003.1)  
PI (pH):   %s   8.58 (8.60) Peptide Signal:   %s   cut: 24 range:24-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSLIRSLCLFSTFLSCIVISVHGQAAARPGLGGTRIGFYSTTCPNAETIVRNAVTSGFSANPRIAPGILRMHFHDCFVQGCDGSVLISGTNTERTAGPNLNLRGFEVIDNAKTQLEAACPGVVSCADILALAARDSVVLTRGINWQVPTGRRDGRVSRASDTNNLPGPGDSVAVQQQKFSALGLNTRELVVLAGGHTIGTAGCGVFRNRLFNSTAGPADPTIDPTFLAQLQTQCPQNGDATVRVDLDTGSGTTFDTSYFNNLSRGRGVLQSDQVLWTNPATRPIVQQLMSPRSTFNAEFARAMVRMSNIGVLTGANGEIRRVCSAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 2 and 3). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTTGATTAGATCATTATGCCTATTCAGTACTTTCCTTAGCTGTATTGTGATCTCGGTCCATGGCCAAGCTGCAGCGAGGCCTGGTCTTGGTGGTACGAGGATTGGGTTTTACTCG
ACCACGTGTCCTAACGCTGAAACCATTGTCCGAAACGCCGTGACATCTGGTTTCAGCGCTAACCCAAGAATCGCACCCGGAATACTAAGAATGCATTTCCACGACTGCTTCGTCCAAGGT
TGTGACGGTTCGGTCCTTATCTCGGGAACTAACACTGAGAGAACTGCCGGTCCGAACCTCAATCTCCGTGGATTTGAAGTCATAGACAACGCCAAAACGCAGCTCGAAGCTGCCTGCCCT
GGAGTCGTCTCTTGTGCTGATATTTTAGCTTTAGCCGCCCGTGACTCCGTCGTCCTC
GTAAGTCATAAATAATTAGTATATTAACATGCATTTAGAATATTTTTTTTGTTAGCAACGTTT
TTACGTGCATGGGTTGATTTGCATGCAGACGAGAGGAATAAATTGGCAAGTACCAACCGGACGTAGAGATGGTCGAGTTTCTCGGGCTTCGGACACTAACAATCTCCCTGGTCCCGGTGA
CTCCGTCGCCGTTCAACAACAGAAATTCTCGGCTTTGGGACTCAATACCCGCGAACTCGTCGTCCTCGCCG
GTCAGTATAGTTACACAATATTCAAGACCTTTATTTAATCAAGAAACTC
TTCATGACTAATGTGAAATACTTGAAATACCCTACGTTTAACACCTAAAGGTCCTAAACCACTTAAGGACTAATTTTCACCCGAATTCATCCATTTTAATTAATTTGTCGGAGTAATTTA
AACATTTATTCGAAAACATGGAAAATCTGATTTGCAAATTTTTTTATAAAATGGATAATTATTAATAACAACATAAACTAAAACAATTATATAATACAACAGGAGGACACACGATCGGAA
CTGCAGGATGCGGTGTATTCAGGAACAGGCTATTTAATAGCACCGCAGGCCCAGCGGATCCAACCATCGACCCGACATTTTTAGCACAGCTTCAGACACAATGTCCCCAAAACGGTGATG
CCACAGTCCGCGTTGATCTCGACACCGGAAGTGGAACCACTTTCGACACTTCCTACTTCAACAACCTAAGCCGTGGCCGTGGAGTCCTCCAATCCGATCAGGTCCTTTGGACCAACCCAG
CCACTAGACCCATTGTGCAACAGTTGATGAGTCCTAGAAGCACTTTCAACGCTGAGTTTGCGAGGGCAATGGTCAGAATGAGTAATATCGGTGTGCTTACGGGGGCTAATGGGGAAATTC
GTAGGGTTTGCTCCGCGGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGTTTGATTAGATCATTATGCCTATTCAGTACTTTCCTTAGCTGTATTGTGATCTCGGTCCATGGCCAAGCTGCAGCGAGGCCTGGTCTTGGTGGTACGAGGATTGGGTTTTACTCG
ACCACGTGTCCTAACGCTGAAACCATTGTCCGAAACGCCGTGACATCTGGTTTCAGCGCTAACCCAAGAATCGCACCCGGAATACTAAGAATGCATTTCCACGACTGCTTCGTCCAAGGT
TGTGACGGTTCGGTCCTTATCTCGGGAACTAACACTGAGAGAACTGCCGGTCCGAACCTCAATCTCCGTGGATTTGAAGTCATAGACAACGCCAAAACGCAGCTCGAAGCTGCCTGCCCT
GGAGTCGTCTCTTGTGCTGATATTTTAGCTTTAGCCGCCCGTGACTCCGTCGTCCTC
ACGAGAGGAATAAATTGGCAAGTACCAACCGGACGTAGAGATGGTCGAGTTTCTCGGGCTTCG
GACACTAACAATCTCCCTGGTCCCGGTGACTCCGTCGCCGTTCAACAACAGAAATTCTCGGCTTTGGGACTCAATACCCGCGAACTCGTCGTCCTCGCCG
GAGGACACACGATCGGAACT
GCAGGATGCGGTGTATTCAGGAACAGGCTATTTAATAGCACCGCAGGCCCAGCGGATCCAACCATCGACCCGACATTTTTAGCACAGCTTCAGACACAATGTCCCCAAAACGGTGATGCC
ACAGTCCGCGTTGATCTCGACACCGGAAGTGGAACCACTTTCGACACTTCCTACTTCAACAACCTAAGCCGTGGCCGTGGAGTCCTCCAATCCGATCAGGTCCTTTGGACCAACCCAGCC
ACTAGACCCATTGTGCAACAGTTGATGAGTCCTAGAAGCACTTTCAACGCTGAGTTTGCGAGGGCAATGGTCAGAATGAGTAATATCGGTGTGCTTACGGGGGCTAATGGGGAAATTCGT
AGGGTTTGCTCCGCGGTTAATTAA

Retrieve as FASTA