Entry information : TsPrx02 (Thhalv10008157m)
Entry ID 9758
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-17 (Christophe Dunand)
Peroxidase information: TsPrx02 (Thhalv10008157m)
Name (synonym) TsPrx02 (Thhalv10008157m)
Class Class III peroxidase    [Orthogroup: Prx044]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx02
start..stop
S start..stop
TsPrx01 579 0 1..332 1..324
BrPrx01-1Ab_other 540 0 1..332 1..340
BrPrx01-1Aa_other 539 0 4..332 3..321
BrPrx02-1Ab_other 531 0 17..332 16..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14090662..14090907 246 N° 2 14091012..14091197 186 N° 3 14091320..14091479 160 N° 4 14091589..14091995 407
join(14090662..14090907,14091012..14091197,14091320..14091479,14091589..14091995 )


exon

Literature and cross-references TsPrx02 (Thhalv10008157m)
DNA ref. Phytozome 11:   scaffold_5 (14090662..14091995)
Protein sequence: TsPrx02 (Thhalv10008157m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (310)
PWM (Da):   %s   36831.54 (34438.1)  
PI (pH):   %s   10.2 (10.15) Peptide Signal:   %s   cut: 23 range:23-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALIKNILVLVVLLSVVGVSFAKPPHRHRNPHMKGGLDLDYYRFKCPQAEAIVRRVTFQYVSRRPSLAAALLRMYFHDCFVRGCDASLLLKSPNKDAERDAVPNLTVRGYEVVDAAKSALERKCPGVVSCADVLALVARDAVLVIKGPWWPVPLGRRDGRISKLSEVNLPSPFADVNALKQDFFAKGLNTKDLVVLSGAHTIGISSCGLINRRIHNFTGKGDFDPSMNPSYVRQLKKRCKPTTPTTIVEMDPGSVKKFDSHYFNIVAQKKGLFKSDSTLLDDLETKLYIQKQVVTRGASFAKDFSESMLKLGFVEILTGTQGEIRKKCAFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTCATCAAGAACATTCTTGTCCTAGTGGTTCTTCTTAGCGTTGTTGGAGTTTCCTTTGCAAAGCCGCCACATAGACATAGGAACCCACATATGAAGGGTGGTCTTGACCTCGAC
TACTACCGCTTCAAGTGTCCACAAGCGGAAGCCATTGTCCGCCGTGTCACATTTCAATACGTTTCTCGCAGGCCAAGTCTTGCTGCTGCGCTTCTGAGAATGTATTTTCATGACTGTTTT
GTCAGA
GTAAGTTGAATTTTCTTAGATTTTGATGTTTTACTAATACATTATTAATCCGAAACTTCGCTAACCCCTACCTTTTTTTGTGTGTACATTATTAATCCGAATAGGGATGTGATG
CTTCCCTTCTTCTGAAATCTCCAAACAAGGATGCGGAAAGAGACGCTGTCCCCAACTTGACAGTGAGAGGCTACGAAGTGGTCGATGCTGCCAAGTCAGCCCTCGAGAGGAAGTGTCCTG
GTGTTGTTTCTTGCGCTGATGTTCTTGCCTTGGTCGCTAGAGACGCTGTTTTAGTG
GTAATGTTTTGCATGCAGCTTATTTTCTCAACCTTCCAAAACCATTTAGCTACATTAGTGTACG
TACCAACTTACTTATTTTGGTCACTTGATTGACTGTTTTCTTCATTTTTTTGTATTAGATCAAAGGACCATGGTGGCCTGTTCCATTGGGGCGTAGGGACGGACGCATATCAAAACTTTC
CGAGGTTAATTTACCATCTCCTTTTGCCGACGTAAATGCATTGAAGCAGGACTTCTTTGCCAAGGGTCTTAACACTAAAGACTTGGTCGTCCTTTCAG
GTAATTCTATACAAACATCTTT
GAATTCTTTAATCTTTTTTTTTTTTTTTTAATATACCTTTTAATGATATAATGAACAGCTGACTATAATATATGGTTTCTTGAGTAGGGGCTCACACCATTGGAATATCTTCTTGCGGTC
TCATCAACAGACGTATCCATAACTTCACTGGCAAAGGCGACTTTGACCCGTCGATGAACCCGAGCTACGTTAGGCAATTGAAAAAGAGATGCAAGCCAACTACTCCCACGACCATAGTGG
AGATGGATCCAGGCAGTGTCAAGAAGTTTGACTCTCACTACTTCAACATTGTGGCTCAGAAGAAGGGTTTGTTCAAATCTGATTCAACACTTCTCGATGACTTGGAGACCAAACTCTACA
TTCAGAAGCAGGTCGTAACCCGTGGGGCTTCCTTCGCCAAAGATTTCTCTGAATCAATGCTCAAACTTGGTTTCGTCGAGATTCTTACCGGGACGCAGGGTGAGATCAGGAAGAAATGCG
CTTTCGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTCATCAAGAACATTCTTGTCCTAGTGGTTCTTCTTAGCGTTGTTGGAGTTTCCTTTGCAAAGCCGCCACATAGACATAGGAACCCACATATGAAGGGTGGTCTTGACCTCGAC
TACTACCGCTTCAAGTGTCCACAAGCGGAAGCCATTGTCCGCCGTGTCACATTTCAATACGTTTCTCGCAGGCCAAGTCTTGCTGCTGCGCTTCTGAGAATGTATTTTCATGACTGTTTT
GTCAGA
GGATGTGATGCTTCCCTTCTTCTGAAATCTCCAAACAAGGATGCGGAAAGAGACGCTGTCCCCAACTTGACAGTGAGAGGCTACGAAGTGGTCGATGCTGCCAAGTCAGCCCTC
GAGAGGAAGTGTCCTGGTGTTGTTTCTTGCGCTGATGTTCTTGCCTTGGTCGCTAGAGACGCTGTTTTAGTG
ATCAAAGGACCATGGTGGCCTGTTCCATTGGGGCGTAGGGACGGACGC
ATATCAAAACTTTCCGAGGTTAATTTACCATCTCCTTTTGCCGACGTAAATGCATTGAAGCAGGACTTCTTTGCCAAGGGTCTTAACACTAAAGACTTGGTCGTCCTTTCAG
GGGCTCAC
ACCATTGGAATATCTTCTTGCGGTCTCATCAACAGACGTATCCATAACTTCACTGGCAAAGGCGACTTTGACCCGTCGATGAACCCGAGCTACGTTAGGCAATTGAAAAAGAGATGCAAG
CCAACTACTCCCACGACCATAGTGGAGATGGATCCAGGCAGTGTCAAGAAGTTTGACTCTCACTACTTCAACATTGTGGCTCAGAAGAAGGGTTTGTTCAAATCTGATTCAACACTTCTC
GATGACTTGGAGACCAAACTCTACATTCAGAAGCAGGTCGTAACCCGTGGGGCTTCCTTCGCCAAAGATTTCTCTGAATCAATGCTCAAACTTGGTTTCGTCGAGATTCTTACCGGGACG
CAGGGTGAGATCAGGAAGAAATGCGCTTTCGTTAACTAA

Retrieve as FASTA