Entry information : TsPrx03 (Thhalv10008189m)
Entry ID 9759
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-17 (Christophe Dunand)
Peroxidase information: TsPrx03 (Thhalv10008189m)
Name (synonym) TsPrx03 (Thhalv10008189m)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx03
start..stop
S start..stop
BrPrx03-1Ac_other 648 0 1..326 1..326
CagraPrx16 642 0 1..326 1..326
CbPrx01 642 0 1..326 1..326
BrPrx03-1Aa_other 640 0 1..326 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14088089..14088301 213 N° 2 14087808..14087996 189 N° 3 14087565..14087727 163 N° 4 14086833..14087248 416
complement(join(14086833..14087248,14087565..14087727,14087808..14087996,1408808 9..14088301))


exon

Literature and cross-references TsPrx03 (Thhalv10008189m)
DNA ref. Phytozome 12:   scaffold_5 (14088301..14086833)
Protein sequence: TsPrx03 (Thhalv10008189m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (302)
PWM (Da):   %s   35185.77 (32560.3) Transmb domain:   %s   i7-24o
PI (pH):   %s   8.33 (8.21) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNCLRTIALSLSLFLLGLIGPIQAQLQMNFYANTCPNAEKIVQDFVSNHVSNAPSLAAALLRMHFHDCFVRGCDGSVLINSTSGNAEKDATPNLTVRGFGFIDAIKSVLEAQCPGIVSCADIIALASRDAVVFTGGPTWSVPTGRRDGRISNASEALANIPPPTSNFTNLQTLFANQGLDLRDLVLLSGAHTIGVSHCSSFTNRLYNFTGRGDQDPALDSQYAANLKSRKCPSLNDNTTIVEMDPGSRKTFDLSYYQLVLKRRGLFQSDSALTTNPTTLQNINQILKGSVESFFSEFAKSMEKMGRINLKTGSAGVVRRQCSIANS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTGCTTGAGAACTATTGCTCTTTCACTCTCTCTGTTTCTTTTGGGATTGATCGGACCAATCCAAGCTCAACTGCAAATGAACTTCTATGCCAATACTTGTCCTAACGCCGAAAAG
ATTGTTCAAGATTTTGTTTCAAACCACGTTTCTAATGCTCCTTCTCTTGCGGCTGCCCTCTTGAGAATGCATTTCCACGACTGTTTTGTCAGG
GTAAACTCTTTTTTTTTGCTCTCTTAT
ATTATGAAACATTACTAATTGGCTAAGGAATTAATAATGAAGGATATATCCACATGTACATGTAGGGTTGTGATGGATCAGTGCTTATAAACTCGACGTCAGGAAACGCGGAGAAGGACG
CAACTCCTAACCTAACGGTTAGAGGGTTTGGTTTCATCGACGCAATCAAATCTGTGCTTGAAGCTCAGTGCCCTGGAATCGTATCTTGCGCTGATATTATCGCTCTAGCATCTCGAGACG
CAGTAGTTTTCACA
GTAAGTGATCCGCATAATACTAATATTGTATAAATACAAATTTTAATATTTTCTCATCATACAAATTTGGTACGTTGTAGGGAGGGCCAACTTGGAGTGTACCAAC
AGGAAGAAGAGATGGAAGAATATCGAACGCATCAGAAGCATTAGCCAACATTCCTCCTCCCACCAGTAACTTCACCAATCTTCAGACACTCTTTGCAAACCAAGGACTTGATCTTAGGGA
CCTTGTCTTACTCTCCG
GTAAAGCCTAAACCCATATATCACACATTGCTAAAAATTAGGTTGGATGGTTTCAAAAGCAAGTATCTTGTCTTGATGTTAAATGTAAATTACAAATGCAAAC
AGATTTCTGTTCGTATATGTTAACGTTTAATTTGCGTTAGTATTAACAATTTACAAAAGAAAATCTGTTACAAATTATATAAACCTACATTTCTAATATCATATAGTGTTACAACTTTAG
TAAAACATTTTTTTTTTGTAACAAGGGTAATAGTAAAACATTTTAACCCTACGTTTCAAGATTAATATTGAAAAATGTGTTGTGCTATAACAGGGGCTCACACTATCGGTGTATCTCACT
GCTCGTCTTTCACAAACCGTCTCTACAATTTCACTGGTCGTGGAGACCAAGATCCGGCCTTAGACAGCCAATACGCAGCCAATCTCAAGTCTAGGAAATGCCCTAGCCTCAACGATAACA
CGACCATCGTGGAAATGGATCCAGGGAGCCGTAAAACGTTTGATCTTAGTTACTACCAGCTCGTTCTCAAGCGTAGAGGTCTGTTTCAATCTGACTCTGCTCTAACCACTAACCCAACGA
CACTCCAAAACATAAACCAGATCTTGAAGGGTTCGGTGGAGAGTTTCTTTTCTGAGTTTGCCAAGTCGATGGAGAAAATGGGTCGGATCAATCTGAAGACTGGGTCAGCAGGAGTGGTTA
GAAGGCAATGTTCCATTGCAAATAGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAATTGCTTGAGAACTATTGCTCTTTCACTCTCTCTGTTTCTTTTGGGATTGATCGGACCAATCCAAGCTCAACTGCAAATGAACTTCTATGCCAATACTTGTCCTAACGCCGAAAAG
ATTGTTCAAGATTTTGTTTCAAACCACGTTTCTAATGCTCCTTCTCTTGCGGCTGCCCTCTTGAGAATGCATTTCCACGACTGTTTTGTCAGG
GGTTGTGATGGATCAGTGCTTATAAAC
TCGACGTCAGGAAACGCGGAGAAGGACGCAACTCCTAACCTAACGGTTAGAGGGTTTGGTTTCATCGACGCAATCAAATCTGTGCTTGAAGCTCAGTGCCCTGGAATCGTATCTTGCGCT
GATATTATCGCTCTAGCATCTCGAGACGCAGTAGTTTTCACA
GGAGGGCCAACTTGGAGTGTACCAACAGGAAGAAGAGATGGAAGAATATCGAACGCATCAGAAGCATTAGCCAACATT
CCTCCTCCCACCAGTAACTTCACCAATCTTCAGACACTCTTTGCAAACCAAGGACTTGATCTTAGGGACCTTGTCTTACTCTCCG
GGGCTCACACTATCGGTGTATCTCACTGCTCGTCT
TTCACAAACCGTCTCTACAATTTCACTGGTCGTGGAGACCAAGATCCGGCCTTAGACAGCCAATACGCAGCCAATCTCAAGTCTAGGAAATGCCCTAGCCTCAACGATAACACGACCATC
GTGGAAATGGATCCAGGGAGCCGTAAAACGTTTGATCTTAGTTACTACCAGCTCGTTCTCAAGCGTAGAGGTCTGTTTCAATCTGACTCTGCTCTAACCACTAACCCAACGACACTCCAA
AACATAAACCAGATCTTGAAGGGTTCGGTGGAGAGTTTCTTTTCTGAGTTTGCCAAGTCGATGGAGAAAATGGGTCGGATCAATCTGAAGACTGGGTCAGCAGGAGTGGTTAGAAGGCAA
TGTTCCATTGCAAATAGTTAA

Retrieve as FASTA