Entry information : TsPrx01 (Thhalv10008202m)
Entry ID 9760
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-17 (Christophe Dunand)
Peroxidase information: TsPrx01 (Thhalv10008202m)
Name (synonym) TsPrx01 (Thhalv10008202m)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx01
start..stop
S start..stop
TsPrx02 573 0 1..324 1..332
BrPrx01-1Aa_other 535 0 4..324 3..321
BrPrx01-1Ac_other 525 0 4..324 3..321
CrubPrx51 521 0 4..324 3..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14094302..14094523 222 N° 2 14094684..14094869 186 N° 3 14094989..14095148 160 N° 4 14095252..14095658 407
join(14094302..14094523,14094684..14094869,14094989..14095148,14095252..14095658 )


exon

Literature and cross-references TsPrx01 (Thhalv10008202m)
DNA ref. Phytozome 12:   scaffold_5 (14094302..14095658)
Protein sequence: TsPrx01 (Thhalv10008202m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (302)
PWM (Da):   %s   35733.46 (33384.0) Transmb domain:   %s   i7-24o
PI (pH):   %s   9.22 (9.06) Peptide Signal:   %s   cut: 23 range:23-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALIKNILALVVLLGVVGLSFAQPHEGGLDLNYYRSKCPQAEAIVRRITFQYVSHRPSFAAALLRMYFHDCFVRGCDASLLLKSPNKDAERDAIPNLTVRGYEVVDAAKTALERKCPGVVSCADVLALVARDAVSVIKGPWWPVPLGRRDGRVSKLSEVNLPSPFADVNALKQDFFAKGLNTKDLVVLSGAHTIGISSCGLISRRIHNFTGNGDFDPSMNPSYVRQLKKRCKPTDRSTMVAMDPGSFKKFDSHYFNVVAQKRGLFTSDSTLLDDVETKHYIQTQVETSGASFDKDFSESMVKLGFVEILTGTQGEIRKRCAFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTCATCAAGAATATTCTTGCCCTTGTAGTTCTTCTTGGCGTTGTTGGTCTTTCCTTTGCACAGCCACATGAGGGTGGTCTTGACCTCAACTACTATCGCTCTAAGTGTCCACAA
GCGGAAGCCATCGTCCGCCGTATCACATTTCAATACGTTTCTCACAGGCCAAGTTTTGCTGCTGCGCTTCTGAGGATGTATTTTCATGACTGTTTTGTCAGA
GTAAGTTGATTTTTATTT
TAAATTGATGTTTTACTAATCTATGATGTACGTCCTTTATATAGTAGTGTTCTCCCTTCAGAGTGGGATCCTAACATATATGGATAAGAAAATGCACTAACCCCTACCTCTTTTTTTTTG
TGTACATTATCAATCCATATAGGGATGTGATGCTTCGCTTCTTCTGAAATCTCCAAACAAGGATGCGGAAAGAGACGCTATCCCCAACTTGACAGTGAGAGGCTACGAAGTGGTCGATGC
TGCCAAGACAGCCCTCGAGAGGAAGTGTCCTGGTGTCGTTTCTTGCGCTGATGTTCTTGCCTTGGTCGCTAGAGACGCTGTTTCAGTG
GTAACATTTTGCATGCAGCTGATTTTCTCGTC
ATTCCAAAACCATTTGATTACATTAGTGTACGTACCAACTTATTTTGGTCACTTGATTGATTGTTTTCTTCATTTTTTTTTTGTTAGATCAAAGGACCATGGTGGCCTGTTCCATTGGGG
CGTAGGGACGGACGCGTATCAAAACTTTCCGAGGTTAATTTACCATCTCCTTTTGCCGACGTAAATGCATTGAAGCAGGACTTCTTCGCCAAGGGTCTTAACACTAAAGACTTGGTCGTC
CTCTCAG
GTAATTCCATACAAACATCTTTAAAATCTTTAACTGTTTTTTTTTTTTAATATACCTTTTTAGGATATGAACTGCTGACTGTAATATATGGTTTCTTGAGCAGGGGCTCACAC
CATTGGAATATCTTCTTGCGGTCTCATCAGCAGACGTATCCATAACTTCACTGGCAATGGTGACTTTGACCCATCGATGAACCCTAGCTACGTTAGGCAGTTGAAGAAGAGATGCAAGCC
AACTGATAGGAGTACCATGGTGGCGATGGACCCAGGAAGTTTCAAGAAGTTTGACTCTCACTACTTCAACGTTGTGGCTCAGAAGAGGGGTTTGTTCACATCTGATTCAACACTTCTCGA
TGACGTGGAGACCAAACACTACATTCAGACGCAGGTTGAAACCAGTGGGGCTTCCTTCGACAAGGATTTCTCTGAATCAATGGTCAAACTTGGTTTCGTCGAGATTCTTACCGGGACGCA
GGGTGAGATCAGGAAGAGATGTGCTTTCGTTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGCTCATCAAGAATATTCTTGCCCTTGTAGTTCTTCTTGGCGTTGTTGGTCTTTCCTTTGCACAGCCACATGAGGGTGGTCTTGACCTCAACTACTATCGCTCTAAGTGTCCACAA
GCGGAAGCCATCGTCCGCCGTATCACATTTCAATACGTTTCTCACAGGCCAAGTTTTGCTGCTGCGCTTCTGAGGATGTATTTTCATGACTGTTTTGTCAGA
GGATGTGATGCTTCGCTT
CTTCTGAAATCTCCAAACAAGGATGCGGAAAGAGACGCTATCCCCAACTTGACAGTGAGAGGCTACGAAGTGGTCGATGCTGCCAAGACAGCCCTCGAGAGGAAGTGTCCTGGTGTCGTT
TCTTGCGCTGATGTTCTTGCCTTGGTCGCTAGAGACGCTGTTTCAGTG
ATCAAAGGACCATGGTGGCCTGTTCCATTGGGGCGTAGGGACGGACGCGTATCAAAACTTTCCGAGGTTAAT
TTACCATCTCCTTTTGCCGACGTAAATGCATTGAAGCAGGACTTCTTCGCCAAGGGTCTTAACACTAAAGACTTGGTCGTCCTCTCAG
GGGCTCACACCATTGGAATATCTTCTTGCGGT
CTCATCAGCAGACGTATCCATAACTTCACTGGCAATGGTGACTTTGACCCATCGATGAACCCTAGCTACGTTAGGCAGTTGAAGAAGAGATGCAAGCCAACTGATAGGAGTACCATGGTG
GCGATGGACCCAGGAAGTTTCAAGAAGTTTGACTCTCACTACTTCAACGTTGTGGCTCAGAAGAGGGGTTTGTTCACATCTGATTCAACACTTCTCGATGACGTGGAGACCAAACACTAC
ATTCAGACGCAGGTTGAAACCAGTGGGGCTTCCTTCGACAAGGATTTCTCTGAATCAATGGTCAAACTTGGTTTCGTCGAGATTCTTACCGGGACGCAGGGTGAGATCAGGAAGAGATGT
GCTTTCGTTAACTAA

Retrieve as FASTA