Entry information : TsPrx04-1 (Thhalv10008244m / ThPrx04-1)
Entry ID 9761
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-17 (Christophe Dunand)
Peroxidase information: TsPrx04-1 (Thhalv10008244m / ThPrx04-1)
Name (synonym) TsPrx04-1 (Thhalv10008244m / ThPrx04-1)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx04-1
start..stop
S start..stop
TsPrx04-2 639 0 1..316 1..316
BrPrx04-1Aa_other 607 0 1..316 1..317
BstrPrx77 602 0 1..316 1..316
AlyPrx04 598 0 1..316 1..316
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10481521..10481718 198 N° 2 10481811..10482002 192 N° 3 10482383..10482551 169 N° 4 10482649..10483040 392
join(10481521..10481718,10481811..10482002,10482383..10482551,10482649..10483040 )


exon

Literature and cross-references TsPrx04-1 (Thhalv10008244m / ThPrx04-1)
DNA ref. Phytozome 11:   scaffold_5 (10481521..10483040)
Protein sequence: TsPrx04-1 (Thhalv10008244m / ThPrx04-1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   317 (297)
PWM (Da):   %s   34328.17 (32120.0)  
PI (pH):   %s   8.08 (7.97) Peptide Signal:   %s   cut: 20 range:20-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIFKILVLLLSLSCFCQAQLSSTFYDQRCPNALSTIRSSIRTAISRERRMAASLIRLHFHDCFVNGCDASVMLVATPTMESERDALANFQSARGFEVIDQAKSAVERVCPGVVSCADIIAVAARDASEYVGGPRYAVKVGRRDSTAAFRAIADSGDLPNFTASLDELSDLFLRKGLNTRDLVALSGAHTLGQAQCVTFKQRLYDNSSDIDAGFSSTRKRRCPVEGGDMTLAPLDQVTPNSFDNNYYRNLMQKKGLLATDQVLFGTGASTDNIVSEYSRNPARFASDYAAAMIKMGDIQTLTGSAGQIRRICTAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATCTTCAAGATTCTTGTGTTGTTGCTAAGCTTGTCTTGTTTCTGCCAAGCACAACTTTCTTCTACTTTCTACGACCAAAGATGTCCAAATGCTCTCTCAACTATCCGATCCTCA
ATCCGAACCGCCATCAGCCGCGAACGTAGAATGGCTGCTTCTCTCATCCGTCTCCATTTCCACGATTGCTTCGTAAAT
GTATGTCATTAACATTTTGATCTAACATGCGTGTGTGTTCAT
GGACCGCTCTAAAATTTGTATTTGGTTTTTTATATACTTTTTTTTTGTAGGGTTGTGATGCATCGGTCATGCTTGTGGCAACTCCTACCATGGAGAGTGAGAGAGATGCGTTAGCAAACT
TTCAATCAGCGAGAGGATTTGAAGTTATTGATCAAGCCAAATCTGCTGTTGAGAGAGTCTGTCCTGGTGTCGTTTCTTGTGCTGATATCATTGCCGTTGCCGCTAGAGACGCTTCTGAAT
AC
GTAAGTATTTATCAGTATCTATAGCCATACGCATTGACATATGTCAGATATATTTACATGGTTAAATTTTATTTTTGATATTTGTAAGAAATAGATATTTCATTTTTAACATAATCTT
ATGTAAGTACTGAATGAATTGTTCATTCCATTTTGTGTTTGAATTTTGCATATACAACTTTTATTTTTACAAGTCTCCATGTTAAAACTCTAAAGTATTTTATTTGAGAAAAAAAGAAAC
ACTATCTATTATAACATTACCATCTAAACGTAAAGATAAAAGAAATTGAGGTCATACGATATGCATTATACATCAGCTTTTTCAATTTGTTTTCTCGTAGTTCTAATAATTCTTTAATAT
GTAAATTTGGTGTCATCAATAGGTCGGAGGTCCACGATACGCAGTAAAGGTTGGTCGGAGAGATTCCACCGCCGCGTTTAGAGCTATTGCAGACAGCGGCGATCTCCCCAACTTCACGGC
AAGCCTCGACGAACTCTCTGATCTCTTCCTTCGAAAAGGTCTCAACACTAGAGACCTCGTCGCTCTCTCAG
GTCAGTCCCCAAAAGAAAAATTCTTATTAGTCGCTAATTTGTTTTAATT
ACTATATTTTAAGAAATTTCTTGTGACACAAGCAACTTCTATTTGCAGGAGCTCACACCTTAGGGCAAGCTCAATGCGTCACGTTCAAGCAAAGGCTTTACGACAACTCGAGCGACATTG
ATGCCGGATTCTCTAGCACACGTAAGCGTCGCTGTCCGGTAGAAGGTGGAGATATGACCCTAGCACCTCTAGATCAAGTGACACCAAATTCGTTCGACAATAACTATTACAGAAACTTGA
TGCAGAAGAAAGGGCTTTTGGCGACCGATCAGGTTTTGTTCGGAACCGGGGCTTCTACAGACAATATTGTGTCGGAATATAGCAGAAACCCAGCTCGATTCGCGTCTGATTACGCAGCTG
CAATGATCAAGATGGGAGATATTCAGACACTCACTGGCTCAGCTGGACAAATCCGGAGGATCTGCACTGCTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCATCTTCAAGATTCTTGTGTTGTTGCTAAGCTTGTCTTGTTTCTGCCAAGCACAACTTTCTTCTACTTTCTACGACCAAAGATGTCCAAATGCTCTCTCAACTATCCGATCCTCA
ATCCGAACCGCCATCAGCCGCGAACGTAGAATGGCTGCTTCTCTCATCCGTCTCCATTTCCACGATTGCTTCGTAAAT
GGTTGTGATGCATCGGTCATGCTTGTGGCAACTCCTACCATG
GAGAGTGAGAGAGATGCGTTAGCAAACTTTCAATCAGCGAGAGGATTTGAAGTTATTGATCAAGCCAAATCTGCTGTTGAGAGAGTCTGTCCTGGTGTCGTTTCTTGTGCTGATATCATT
GCCGTTGCCGCTAGAGACGCTTCTGAATAC
GTCGGAGGTCCACGATACGCAGTAAAGGTTGGTCGGAGAGATTCCACCGCCGCGTTTAGAGCTATTGCAGACAGCGGCGATCTCCCCAAC
TTCACGGCAAGCCTCGACGAACTCTCTGATCTCTTCCTTCGAAAAGGTCTCAACACTAGAGACCTCGTCGCTCTCTCAG
GAGCTCACACCTTAGGGCAAGCTCAATGCGTCACGTTCAAG
CAAAGGCTTTACGACAACTCGAGCGACATTGATGCCGGATTCTCTAGCACACGTAAGCGTCGCTGTCCGGTAGAAGGTGGAGATATGACCCTAGCACCTCTAGATCAAGTGACACCAAAT
TCGTTCGACAATAACTATTACAGAAACTTGATGCAGAAGAAAGGGCTTTTGGCGACCGATCAGGTTTTGTTCGGAACCGGGGCTTCTACAGACAATATTGTGTCGGAATATAGCAGAAAC
CCAGCTCGATTCGCGTCTGATTACGCAGCTGCAATGATCAAGATGGGAGATATTCAGACACTCACTGGCTCAGCTGGACAAATCCGGAGGATCTGCACTGCTGTTAATTAA

Retrieve as FASTA