Entry information : TsPrx34(Thhalv10010494m)
Entry ID 9764
Creation 0000-00-00 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Bruno Savelli
Last annotation changes 2015-11-12 (Bruno Savelli)
Peroxidase information: TsPrx34(Thhalv10010494m)
Name TsPrx34(Thhalv10010494m)
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type Leaves
Inducer Cold stress
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx34
start..stop
S start..stop
BrPrx34-1Ab_other 674 0 8..355 2..349
BstrPrx03 654 0 6..355 4..353
AtPrx34 653 0 14..355 12..353
AtPrx33 653 0 14..355 13..354
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3227287..3227523 237 N° 2 3225892..3226083 192 N° 3 3225265..3225433 169 N° 4 3224681..3225150 470
complement(join(3224681..3225150,3225265..3225433,3225892..3226083,3227287..3227 523))


exon

Literature and cross-references TsPrx34(Thhalv10010494m)
Literature Wong,C.E., Li,Y., Whitty,B.R., Diaz-Camino,C., Akhter,S.R., Brandle ,J.E., Golding,G.B., Weretilnyk,E.A., Moffatt,B.A. and Griffith,M. Expressed sequence tags from the Yukon ecotype of Thellungiella reveal that gene expression in response to cold, drought and salinity shows little overlap, Plant Mol. Biol. 58 (4), 561-574 (2005)
DNA ref. Phytozome 11:   scaffold_16 (3227523..3224681)
EST ref. GenBank:   DN775209.1   DN776916.1 [5' end]
Protein sequence: TsPrx34(Thhalv10010494m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (323)
PWM (Da):   %s   38948.5 (35385.8)  
PI (pH):   %s   7.29 (7.31) Peptide Signal:   %s   cut: 33 range:33-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPFSSSSYSTSSTWTILITLACLMLRAPLSDAQLTPTFYDTSCPNVANIVRDTIVNELRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAAGNANSARGFPVIDRMKAAVERACPRTVSCADMLTIAAQQSVTLAGGPSWRVPLGRRDSVQAFLDLANRNLPAPFFTLPQLKENFARVGLNRPSDLVALSGGHTFGKNQCRFIMDRLYNFSNTGLPDPTLNTTYLQTLRGLCPQSGNLSALVDFDLRTPTVFDNKYYVNLKEQKGLIQSDQELFSSPNATDTIPLVRAYADGTQTFFNAFVEAMNRMGNISPTTGTQGQIRLNCRVVNSNSLLHDVAEVVDFVSSM

Retrieve as FASTA  
Remarks Complete sequence fromm genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTTCTCGTCTTCTTCTTATTCTACTTCGTCCACTTGGACAATCTTAATCACATTGGCATGTCTTATGCTTCGTGCGCCTTTGTCCGATGCTCAGCTTACCCCTACCTTCTACGAC
ACTTCATGTCCTAACGTCGCTAACATCGTACGAGACACCATTGTCAACGAGCTAAGATCGGACCCTCGTATCGCCGCGAGCATCCTCCGACTTCACTTCCACGACTGCTTTGTTAAT
GTA
AGATATTACTTTCCATATATTTCTAATGCATTATGAATACTTTGTGTTTTATCTTCTAAATACTAATAAACCAGTGTAGAATAAAAAGTAATAACAAATATAGATTTTCGGCGGCAGAAC
ACACAATTGTTTTAGTTAATATTCTCTCTGTTCTAAATTAAATGTTATCTTAGCATTGCTTTTTATGTATGAAAATAATTATCTGTTTTTATTTCAATAGAAATTTCAGTATTAAATATC
AATTTGTCTTCAAATCAAATTAATAAAATATAAAAGAAATGGTCAATTTGTTTGTAGGAGTATAACGTAATTTTTTGACATGTTTTTTTTTTAATTTACGTGAAAAAATGTTAAAACGAC
GTCAAATATAAAATTGATAGATTATGTATCAAAGCAATATTCCATAAAAATTGTGGTATTAAAATAATTATAGTCCTTTTGAATTTAATTGGGTTCATTTTTTTTTCTTTTAAAATATTT
TTCAAGTATTCAATTTTACAAATTAGAAGTGAACTTGCTTGGTCTTGTACTTGGTCCAAAAGGTTATAAACCTAGGTTCGGAAATTTTTTATAGTAAAAAAAAAACATTAAAAGCCCCTT
ATTTGTTATCTGTCATGTAGAGTTTTCAATATAACACATGACAGATTGATAGGTTGAAAAAAAAACAAAAAATAGTTCTAAGGGTACTTGTATATTTAATTGAAAGGTTAATTCGAAAGA
TCTAATCAATACTACACGATTTTTTTTTTTTTTTGGGGCTGACAGTTAGGGTGAAACACTCCTAAATAAAAAGTCACTCAACGGGTTTGATCCAGAAAAACATCAATAAAACATTTCACA
TGTTTTTGCTAATGAATTTACTCTTGTTGACAATCATCTTGGTTAGGTTAATTATTAATTTCTTACACAAGGATCATGCATTCATGCCAAACATTTATGAAAATATCCGTGTTACATAAT
AATATAGAAAAAAACCATGGTGCCGTACCAAACACGGTATGGATACAAAAAGCAATCAATCATATTAGGGATATAGAAAAATATATTTGTGAAATTAATAAAAGGTCTCACGTCTTCTGA
ACCCGAAGAACATTTAGATACTATAAAAATAACTTTTATTTCTTTGATTTAGCTTAGATATATTTTTTTATCTTGACTAATAATTTGTTAAAATAACAATTTGTATTTCTTTAAAAAAAG

GGTTGTGACGCATCGATCTTGTTGGACAACACCACATCATTCCGAACAGAGAAAGATGCAGCTGGAAACGCAAATTCGGCTCGGGGATTTCCTGTGATTGATAGAATGAAAGCCGCAGTG
GAGAGGGCTTGCCCACGAACCGTTTCATGCGCAGATATGCTCACCATCGCTGCTCAACAATCTGTTACTTTG
GTATGTTCTCTGTTAGTTAATGCGTTTGTCTTTCATTTGTTTATTACA
AAATATAGCTTTTCAATCTTAATATATCAAGTCGTCGTTTTACAGTATTCAAAACGCGTGGTCCTGTAAAGAAAATCTGACATGTTTTAGAAAGTAAATCTCATCACGAGGATATATATG
ATTGTTTAGAGAAGACTGCTCATTTTTAGGTACCGATAATCAATGAGATTTAATACGATGTCGATTCAAAATTGATGTCTACTCGTACTTAACTCATGATCACGAGAAAATTCATATAAA
ATAAAAACTTCACTTCAAGTATATAATTAATTAATTTACATTATATGTTAGTGTTTTTTTTCATATCTACACATTTAAACTTCCAAATGATAAGAATAATCTCTAAAACATCGAAAAAAG
AGAGTCTAGAAATAATAGTTACTTTGAATATAATGATTCTTATATTATAGGCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGGAGAAGAGACAGCGTACAAGCATTTTTGGATCTAGCTA
ATAGAAATCTTCCAGCTCCATTCTTCACACTTCCACAACTTAAGGAAAATTTTGCAAGAGTTGGTCTCAATCGTCCTTCTGATCTTGTTGCTCTTTCCG
GTAATTAAAAAAAAACTAATT
AATTAAATACCATATGATATAATAGTTTTGAACTTTTGATTAATTATTGATTTTACTATACTGATGTTTTTATATTGGTCTTTCTTTGGTTAGGGGGTCACACATTTGGTAAAAATCAAT
GCCGATTCATTATGGACAGATTATACAATTTCAGCAACACCGGTTTACCCGACCCGACCCTCAACACTACTTACCTCCAAACTCTTCGTGGACTATGTCCCCAAAGTGGCAACTTAAGTG
CCCTGGTAGATTTTGATCTGCGTACGCCTACGGTTTTCGACAACAAGTACTATGTGAATCTCAAAGAACAAAAAGGTCTTATCCAGAGTGACCAAGAGTTGTTCTCTAGTCCCAATGCAA
CTGACACAATCCCCTTGGTGAGGGCATATGCTGATGGCACACAAACATTCTTCAATGCGTTCGTGGAGGCGATGAATAGGATGGGAAACATTTCGCCTACTACAGGGACTCAAGGACAGA
TCAGGTTGAATTGTAGGGTGGTTAACTCTAACTCTCTACTCCATGATGTGGCCGAGGTCGTCGACTTTGTTAGCTCTATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTTTCTCGTCTTCTTCTTATTCTACTTCGTCCACTTGGACAATCTTAATCACATTGGCATGTCTTATGCTTCGTGCGCCTTTGTCCGATGCTCAGCTTACCCCTACCTTCTACGAC
ACTTCATGTCCTAACGTCGCTAACATCGTACGAGACACCATTGTCAACGAGCTAAGATCGGACCCTCGTATCGCCGCGAGCATCCTCCGACTTCACTTCCACGACTGCTTTGTTAAT
GGT
TGTGACGCATCGATCTTGTTGGACAACACCACATCATTCCGAACAGAGAAAGATGCAGCTGGAAACGCAAATTCGGCTCGGGGATTTCCTGTGATTGATAGAATGAAAGCCGCAGTGGAG
AGGGCTTGCCCACGAACCGTTTCATGCGCAGATATGCTCACCATCGCTGCTCAACAATCTGTTACTTTG
GCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGGAGAAGAGACAGCGTACAA
GCATTTTTGGATCTAGCTAATAGAAATCTTCCAGCTCCATTCTTCACACTTCCACAACTTAAGGAAAATTTTGCAAGAGTTGGTCTCAATCGTCCTTCTGATCTTGTTGCTCTTTCCG
GG
GGTCACACATTTGGTAAAAATCAATGCCGATTCATTATGGACAGATTATACAATTTCAGCAACACCGGTTTACCCGACCCGACCCTCAACACTACTTACCTCCAAACTCTTCGTGGACTA
TGTCCCCAAAGTGGCAACTTAAGTGCCCTGGTAGATTTTGATCTGCGTACGCCTACGGTTTTCGACAACAAGTACTATGTGAATCTCAAAGAACAAAAAGGTCTTATCCAGAGTGACCAA
GAGTTGTTCTCTAGTCCCAATGCAACTGACACAATCCCCTTGGTGAGGGCATATGCTGATGGCACACAAACATTCTTCAATGCGTTCGTGGAGGCGATGAATAGGATGGGAAACATTTCG
CCTACTACAGGGACTCAAGGACAGATCAGGTTGAATTGTAGGGTGGTTAACTCTAACTCTCTACTCCATGATGTGGCCGAGGTCGTCGACTTTGTTAGCTCTATGTGA

Retrieve as FASTA