Entry information : TsPrx35 (Thhalv10010538m)
Entry ID 9765
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-24 (Christophe Dunand)
Peroxidase information: TsPrx35 (Thhalv10010538m)
Name (synonym) TsPrx35 (Thhalv10010538m)
Class Class III peroxidase    [Orthogroup: Prx010]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx35
start..stop
S start..stop
BstrPrx76 632 0 1..329 1..329
CagraPrx07 627 0 1..329 1..329
CrubPrx102 623 0 1..329 1..329
AlyPrx35 619 0 1..329 1..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2730885..2731100 216 N° 2 2731187..2731387 201 N° 3 2731486..2731651 166 N° 4 2731772..2732178 407
join(2730885..2731100,2731187..2731387,2731486..2731651,2731772..2732178)


exon

Literature and cross-references TsPrx35 (Thhalv10010538m)
DNA ref. Phytozome 11:   scaffold_16 (2730885..2732178)
Protein sequence: TsPrx35 (Thhalv10010538m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (304)
PWM (Da):   %s   36197.64 (33408.2)  
PI (pH):   %s   10.21 (10.28) Peptide Signal:   %s   cut: 26 range:26-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARFSMVLVVALCVTIFVLPDPTTAQLSRNFYSKTCPNIEQIVRNVVQKKVKQTFVTIPATLRLFFHDCFVNGCDASVMIQSTPKNKAEKDHPDNVSLAGDGFDVVIQAKKALDANPRCRNKVSCADILTLATRDVVVAAGGPSYEVELGRFDGLVSTASSVQGNLPGPSDNVNKLNALFKKNKLTQEDMIALSAAHTLGFAHCGKVFKRIYNFNRTMSVDPTLNKAYAKDLQMACPKNVDPRIAINMDPVTPKKFDNVYFKNLQQGKGLFTSDQVLFTDGRSRPTVNAWARDSKAFNRAFVTAMTKLGRVGVKNSRNGNIRRDCGAFN*

Retrieve as FASTA  
Remarks Complete sequence fromm genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGCTTCAGTATGGTTCTAGTCGTGGCTCTTTGCGTCACAATCTTTGTCCTACCCGATCCAACCACCGCGCAGCTAAGCCGCAATTTCTACTCCAAAACTTGCCCCAACATCGAA
CAAATTGTGAGAAACGTTGTCCAAAAGAAAGTAAAGCAGACATTCGTCACCATCCCTGCCACACTCCGTCTCTTCTTCCACGATTGCTTTGTCAAT
GTACGTTTTCATATCCTTTTTTCC
TTCAACTTCATTATCCAATTAATAGGTTTCTTAGTTATATTTTGGGGTAACTCGCATTGTAGGGTTGTGATGCCTCAGTTATGATTCAATCTACACCTAAGAACAAGGCGGAGAAGGATC
ATCCCGACAATGTTTCCTTGGCCGGAGATGGATTTGATGTGGTGATCCAAGCTAAGAAAGCCCTTGACGCTAACCCTCGTTGCCGGAACAAGGTCTCATGCGCTGATATTCTAACATTGG
CCACCAGAGATGTCGTTGTTGCT
GTAAGTAAACTTACTTTTAACTATAAATTAAAAAGGTACAACGCATTATTGCTTGTTTTGGAATGTTTTAAGAAACAAGGTTTCACGCATGTATATA
GGCTGGAGGACCATCCTATGAAGTCGAGCTTGGTAGGTTCGATGGATTGGTATCAACTGCATCTAGCGTCCAAGGAAACTTACCAGGACCTTCTGACAATGTAAACAAACTTAACGCTCT
TTTCAAGAAAAACAAACTTACCCAAGAAGATATGATCGCTCTTTCAG
GTAAATCAACTTAAAAAATATTATAACATTGTAATAAATGCAAACGTAAAATACATGTATTTTACAGTCTATC
ACCAAAATACATTGATAACTAAACCGATGAGATTCATAATGTTGTAGCGGCTCACACACTTGGATTCGCACATTGCGGCAAAGTCTTCAAGAGAATCTACAACTTCAACCGTACGATGTC
CGTTGACCCCACACTAAACAAGGCATACGCTAAGGATCTACAAATGGCTTGTCCTAAGAATGTGGACCCGAGAATCGCGATCAACATGGATCCAGTCACGCCCAAGAAGTTCGACAACGT
TTACTTCAAGAACCTTCAACAAGGCAAAGGTCTATTCACATCCGATCAAGTTCTCTTCACCGATGGCCGCTCAAGGCCCACCGTTAATGCTTGGGCCAGAGACTCTAAAGCGTTTAACCG
CGCGTTTGTGACCGCTATGACCAAACTCGGTCGCGTTGGGGTTAAGAATAGCCGTAATGGAAATATCCGTCGTGACTGTGGTGCGTTTAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGCTTCAGTATGGTTCTAGTCGTGGCTCTTTGCGTCACAATCTTTGTCCTACCCGATCCAACCACCGCGCAGCTAAGCCGCAATTTCTACTCCAAAACTTGCCCCAACATCGAA
CAAATTGTGAGAAACGTTGTCCAAAAGAAAGTAAAGCAGACATTCGTCACCATCCCTGCCACACTCCGTCTCTTCTTCCACGATTGCTTTGTCAAT
GGTTGTGATGCCTCAGTTATGATT
CAATCTACACCTAAGAACAAGGCGGAGAAGGATCATCCCGACAATGTTTCCTTGGCCGGAGATGGATTTGATGTGGTGATCCAAGCTAAGAAAGCCCTTGACGCTAACCCTCGTTGCCGG
AACAAGGTCTCATGCGCTGATATTCTAACATTGGCCACCAGAGATGTCGTTGTTGCT
GCTGGAGGACCATCCTATGAAGTCGAGCTTGGTAGGTTCGATGGATTGGTATCAACTGCATCT
AGCGTCCAAGGAAACTTACCAGGACCTTCTGACAATGTAAACAAACTTAACGCTCTTTTCAAGAAAAACAAACTTACCCAAGAAGATATGATCGCTCTTTCAG
CGGCTCACACACTTGGA
TTCGCACATTGCGGCAAAGTCTTCAAGAGAATCTACAACTTCAACCGTACGATGTCCGTTGACCCCACACTAAACAAGGCATACGCTAAGGATCTACAAATGGCTTGTCCTAAGAATGTG
GACCCGAGAATCGCGATCAACATGGATCCAGTCACGCCCAAGAAGTTCGACAACGTTTACTTCAAGAACCTTCAACAAGGCAAAGGTCTATTCACATCCGATCAAGTTCTCTTCACCGAT
GGCCGCTCAAGGCCCACCGTTAATGCTTGGGCCAGAGACTCTAAAGCGTTTAACCGCGCGTTTGTGACCGCTATGACCAAACTCGGTCGCGTTGGGGTTAAGAATAGCCGTAATGGAAAT
ATCCGTCGTGACTGTGGTGCGTTTAACTAG

Retrieve as FASTA