Entry information : TsPrx36 (Thhalv10011077m)
Entry ID 9766
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-24 (Christophe Dunand)
Peroxidase information: TsPrx36 (Thhalv10011077m)
Name (synonym) TsPrx36 (Thhalv10011077m)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx36
start..stop
S start..stop
BrPrx36-1Aa_other 608 0 1..337 1..337
BoPrx36_other 595 0 1..337 1..337
AalpPrx36 595 0 1..340 1..340
BnPrx36-1C_other 590 0 1..337 1..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2142887..2143129 243 N° 2 2142585..2142776 192 N° 3 2142335..2142500 166 N° 4 2141611..2142032 422
complement(join(2141611..2142032,2142335..2142500,2142585..2142776,2142887..2143 129))


exon

Literature and cross-references TsPrx36 (Thhalv10011077m)
DNA ref. Phytozome 12:   scaffold_16 (2143129..2141611)
Protein sequence: TsPrx36 (Thhalv10011077m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (316)
PWM (Da):   %s   37757.48 (35026.0)  
PI (pH):   %s   5.2 (5.18) Peptide Signal:   %s   cut: 25 range:25-340
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKSIMCIVLTEISLVALFHICICYQTNECTSTPSLSPQFYNSSCPKAQTIVQSFVAKAYSNDPRMAASLLRLHFHDCFVNGCEASLLLDNSGTMESEKRSVSNQDSARGFEVIDDIKSALENECPQTVSCADILAIVARDTTVITGGPSWEVYLGRRDAREANLKGSNDNIPLSNSTFESIVTMFNVQGLDLTDVVALLGSHTIGNSRCKSFRQRLYNQSGNSDLDQTLNQNYASMLQQGCPISGDDQNLFALDYVTPTKFDNYYFKNLMTFKGLLSSDEVLFTKSRVSMQLVKLYAENEEAFFEQFAKSMVKMGNISPLTGTNGEIRRICRRVNHVDV*

Retrieve as FASTA  
Remarks Complete sequence fromm genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAGTCAATAATGTGCATTGTTCTCACTGAAATTTCCCTCGTTGCCTTGTTTCATATTTGTATATGTTATCAAACCAACGAATGCACGAGCACCCCCTCTCTCTCCCCACAGTTT
TACAACAGCTCTTGCCCAAAAGCTCAAACAATCGTTCAATCATTTGTCGCCAAAGCATACTCCAACGACCCTCGCATGGCTGCCTCATTGCTTAGGCTTCATTTCCATGATTGTTTCGTC
AAT
GTTTGACAACAACTAATCTCTTTTTTTTACTCAATGTTTGATATGAATTTATGGATAAATATAAATTCAGTCTTAGTATATGGATCTTGCTTGCTTTTTGGGTGGTGCAGGGATGTG
AAGCTTCATTATTATTGGACAATAGCGGAACGATGGAAAGCGAGAAACGATCAGTCTCAAACCAAGACTCTGCTCGAGGGTTCGAAGTCATCGACGATATCAAGTCTGCCTTGGAAAATG
AATGTCCACAAACAGTTTCTTGCGCTGATATTTTGGCTATCGTCGCTAGAGACACCACTGTTATT
GTATGTCAATTCTTGTAACACAAGAGAATCATTAGAGTTGATAAATGTTACTAAA
GCTCGTAAATTAATGAAATTTATATACAGACCGGTGGACCGAGTTGGGAAGTATATCTAGGAAGAAGAGACGCAAGAGAAGCAAACTTGAAAGGTTCCAACGACAACATTCCTCTTTCTA
ACTCCACGTTTGAGAGCATCGTCACCATGTTCAACGTTCAAGGACTCGATCTGACCGATGTTGTTGCTCTCTTAG
GTAATGTATTTGTTAATACACCCGAAGTCGGGATCTTAGCTTATG
ATTTAAAATTTAATTTGGGTTTAAAATTTAATTTTTTTTTCGGGTGGGTCCGTATATTTGGAATTTCAGGTTTAACATTTACTTCTTAGGATTGAGTTTTTCTTTTTGTTAAATTTGAAA
AAACAAAATATTTTCTTAGATACACTTTCTAACATAATGTCTCTCATATTTTATGTCAAAGATATTTTGCACGACAAATTACATATGAATAAATCAATATTGTAACTTTTAAATTAAGAA
CCATGATTCGAGCGTAGGAAGTCATACGATAGGAAACTCGAGGTGCAAGAGTTTCCGACAAAGGCTATACAACCAATCTGGAAACAGCGATCTTGACCAGACTTTGAATCAAAACTACGC
CTCTATGTTGCAGCAGGGGTGTCCGATTTCCGGTGACGACCAGAACCTCTTTGCTCTCGACTATGTGACGCCAACTAAGTTTGACAACTACTACTTCAAGAACCTGATGACGTTTAAAGG
ACTCTTGAGTTCTGATGAGGTGTTGTTCACAAAGAGCAGAGTCTCCATGCAGCTGGTCAAGCTTTATGCGGAGAATGAGGAAGCCTTCTTTGAGCAGTTCGCGAAGTCGATGGTGAAGAT
GGGAAATATCTCGCCGTTGACTGGGACAAATGGTGAGATCCGGAGGATCTGCCGGAGAGTTAATCACGTAGACGTCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAAAGTCAATAATGTGCATTGTTCTCACTGAAATTTCCCTCGTTGCCTTGTTTCATATTTGTATATGTTATCAAACCAACGAATGCACGAGCACCCCCTCTCTCTCCCCACAGTTT
TACAACAGCTCTTGCCCAAAAGCTCAAACAATCGTTCAATCATTTGTCGCCAAAGCATACTCCAACGACCCTCGCATGGCTGCCTCATTGCTTAGGCTTCATTTCCATGATTGTTTCGTC
AAT
GGATGTGAAGCTTCATTATTATTGGACAATAGCGGAACGATGGAAAGCGAGAAACGATCAGTCTCAAACCAAGACTCTGCTCGAGGGTTCGAAGTCATCGACGATATCAAGTCTGCC
TTGGAAAATGAATGTCCACAAACAGTTTCTTGCGCTGATATTTTGGCTATCGTCGCTAGAGACACCACTGTTATT
ACCGGTGGACCGAGTTGGGAAGTATATCTAGGAAGAAGAGACGCA
AGAGAAGCAAACTTGAAAGGTTCCAACGACAACATTCCTCTTTCTAACTCCACGTTTGAGAGCATCGTCACCATGTTCAACGTTCAAGGACTCGATCTGACCGATGTTGTTGCTCTCTTA
G
GAAGTCATACGATAGGAAACTCGAGGTGCAAGAGTTTCCGACAAAGGCTATACAACCAATCTGGAAACAGCGATCTTGACCAGACTTTGAATCAAAACTACGCCTCTATGTTGCAGCAG
GGGTGTCCGATTTCCGGTGACGACCAGAACCTCTTTGCTCTCGACTATGTGACGCCAACTAAGTTTGACAACTACTACTTCAAGAACCTGATGACGTTTAAAGGACTCTTGAGTTCTGAT
GAGGTGTTGTTCACAAAGAGCAGAGTCTCCATGCAGCTGGTCAAGCTTTATGCGGAGAATGAGGAAGCCTTCTTTGAGCAGTTCGCGAAGTCGATGGTGAAGATGGGAAATATCTCGCCG
TTGACTGGGACAAATGGTGAGATCCGGAGGATCTGCCGGAGAGTTAATCACGTAGACGTCTAA

Retrieve as FASTA