Entry information : TsPrx09 (Thhalv10011616m)
Entry ID 9767
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-24 (Christophe Dunand)
Peroxidase information: TsPrx09 (Thhalv10011616m)
Name (synonym) TsPrx09 (Thhalv10011616m)
Class Class III peroxidase    [Orthogroup: Prx037]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx09
start..stop
S start..stop
BrPrx09-1Aa_other 674 0 1..352 1..347
CrubPrx52 622 0 1..352 1..346
BstrPrx25 622 0 1..352 21..366
AlyPrx09 619 0 1..352 1..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10774564..10774851 288 N° 2 10774297..10774488 192 N° 3 10774047..10774212 166 N° 4 10773231..10773643 413
complement(join(10773231..10773643,10774047..10774212,10774297..10774488,1077456 4..10774851))


exon

Literature and cross-references TsPrx09 (Thhalv10011616m)
DNA ref. Phytozome 11:   scaffold_7 (10774851..10773231)
Protein sequence: TsPrx09 (Thhalv10011616m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   353 (329)
PWM (Da):   %s   38288.31 (35778.9)  
PI (pH):   %s   7.44 (7.40) Peptide Signal:   %s   cut: 24 range:24-352
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAISKLIHGLVFIALLSFDVGVAHPGYEHPGFGFGWGSNGPSIGRTFSSGLFPQFYQFSCPQADEIVMTVLEKTIARNPRMAASLLRLHFHDCFVQGCDASILLDDSATIRSEKNAGPNKNSIKGFEVIDEIKAKLEQVCPQVVSCADILALAARGSTMLSGGPSWELPLGRRDSRSASLNGANTNIPAPNSTIQNLLTMFQRKGLNQEDLVSLSGGHTIGVARCTTFKQRLYNQNGNNQPDSTLERSYYYGLRSICPPTGGDNNISPLDLASPARFDNTYFKLILWGKGLLTSDQVLLTGNVGKTTELVKAYAEDESVFFEQFAKSMVNMGNIQPLTGINGEIRKNCHVIN

Retrieve as FASTA  
Remarks Complete sequence fromm genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATCTCAAAGCTTATTCATGGTCTTGTGTTCATTGCTTTGTTGTCTTTTGATGTTGGTGTTGCGCATCCCGGTTATGAGCATCCCGGTTTTGGGTTTGGATGGGGAAGTAATGGC
CCCAGTATTGGAAGAACTTTTTCCTCAGGTCTTTTCCCACAATTCTACCAGTTCTCTTGTCCACAAGCTGATGAGATTGTCATGACGGTTCTTGAAAAAACCATCGCCAGAAACCCAAGA
ATGGCTGCATCTTTACTCAGGCTTCACTTCCACGACTGCTTTGTCCAG
GTTCTGCACTGACCTATTTTGTCCTTTATTTAATTTCTCATACGCTTTTAACACTTAACACTCTTTTGTAAA
CAGGGTTGTGATGCATCAATCTTGTTGGATGATAGTGCTACCATAAGAAGTGAAAAGAATGCAGGTCCAAACAAGAACTCCATTAAAGGGTTTGAAGTAATAGACGAGATCAAAGCCAAA
CTAGAGCAAGTTTGCCCTCAAGTTGTCTCTTGCGCCGACATTCTAGCTCTTGCTGCTCGCGGCTCAACTATGCTG
GTAAATAAAGACCTTCAAGGGAAAACTATTGGTTTCAAGTTACAT
ATATAGCACTGCTTTTTCTGAATTTGTGATTTAATACAGAGTGGTGGACCATCATGGGAGCTTCCACTCGGGAGGAGAGACTCGAGGTCAGCGAGCCTCAATGGAGCAAACACGAACATT
CCTGCACCTAACTCGACTATTCAGAATCTCTTAACCATGTTCCAACGCAAAGGTTTGAACCAAGAAGACCTTGTTTCCCTATCAG
GTGAGCCTAATATGTATTTTTCTTTTGTTATAGGA
ATTGACATGAAACCGAACTGAACCCAAATTTAGTGCAACCATAAGTTTTGTTATGTAGTATTTTAATATTGTTATACTAAACATTACTTTAAATTATACTAAAAATATATAAGTATTCCT
CCCTTCAAGTTAATTGTGGTTTAGGATTATCTTTTTTTTTTTTGGTTTTAAAATAAGTGCTGTTTTAGATTTTGAAGGAAAATTTTAACTTAAAATACTCAATTCAACCGAAAATTTTAA
ATTAATAACTAAACAGAATACCAGTAGTCTACTACTCTATCCGTTTCAAAATAAATATCGCTTTGACCTTTTTCACAAGAATTAAGAAAACATATTAACAAACTGGATTGGGATTTGTGT
GTTTGCAGGAGGACATACGATTGGAGTAGCGAGGTGCACAACGTTCAAACAAAGACTCTACAATCAAAACGGTAATAACCAACCAGACTCGACGCTAGAGAGGTCTTACTACTACGGTCT
CAGATCGATTTGTCCACCAACGGGCGGCGACAACAATATCTCACCTCTAGACTTAGCCTCTCCAGCTAGATTCGACAACACATACTTCAAGCTTATCCTCTGGGGCAAAGGCTTATTGAC
ATCAGACCAAGTGCTACTCACTGGCAACGTAGGCAAGACAACTGAATTGGTGAAAGCTTATGCAGAAGACGAAAGCGTTTTCTTCGAGCAATTTGCAAAGTCGATGGTAAACATGGGGAA
CATTCAGCCTCTAACTGGTATTAATGGTGAGATCAGGAAGAACTGTCACGTCATTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTATCTCAAAGCTTATTCATGGTCTTGTGTTCATTGCTTTGTTGTCTTTTGATGTTGGTGTTGCGCATCCCGGTTATGAGCATCCCGGTTTTGGGTTTGGATGGGGAAGTAATGGC
CCCAGTATTGGAAGAACTTTTTCCTCAGGTCTTTTCCCACAATTCTACCAGTTCTCTTGTCCACAAGCTGATGAGATTGTCATGACGGTTCTTGAAAAAACCATCGCCAGAAACCCAAGA
ATGGCTGCATCTTTACTCAGGCTTCACTTCCACGACTGCTTTGTCCAG
GGTTGTGATGCATCAATCTTGTTGGATGATAGTGCTACCATAAGAAGTGAAAAGAATGCAGGTCCAAACAAG
AACTCCATTAAAGGGTTTGAAGTAATAGACGAGATCAAAGCCAAACTAGAGCAAGTTTGCCCTCAAGTTGTCTCTTGCGCCGACATTCTAGCTCTTGCTGCTCGCGGCTCAACTATGCTG
AGTGGTGGACCATCATGGGAGCTTCCACTCGGGAGGAGAGACTCGAGGTCAGCGAGCCTCAATGGAGCAAACACGAACATTCCTGCACCTAACTCGACTATTCAGAATCTCTTAACCATG
TTCCAACGCAAAGGTTTGAACCAAGAAGACCTTGTTTCCCTATCAG
GAGGACATACGATTGGAGTAGCGAGGTGCACAACGTTCAAACAAAGACTCTACAATCAAAACGGTAATAACCAA
CCAGACTCGACGCTAGAGAGGTCTTACTACTACGGTCTCAGATCGATTTGTCCACCAACGGGCGGCGACAACAATATCTCACCTCTAGACTTAGCCTCTCCAGCTAGATTCGACAACACA
TACTTCAAGCTTATCCTCTGGGGCAAAGGCTTATTGACATCAGACCAAGTGCTACTCACTGGCAACGTAGGCAAGACAACTGAATTGGTGAAAGCTTATGCAGAAGACGAAAGCGTTTTC
TTCGAGCAATTTGCAAAGTCGATGGTAAACATGGGGAACATTCAGCCTCTAACTGGTATTAATGGTGAGATCAGGAAGAACTGTCACGTCATTAATTAA

Retrieve as FASTA