Entry information : TsPrx10 (Thhalv10011619m)
Entry ID 9768
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-24 (Christophe Dunand)
Peroxidase information: TsPrx10 (Thhalv10011619m)
Name (synonym) TsPrx10 (Thhalv10011619m)
Class Class III peroxidase    [Orthogroup: Prx021]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx10
start..stop
S start..stop
BstrPrx66 644 0 6..347 8..350
AhalPrx15 641 0 1..347 1..350
AlyPrx10 640 0 1..347 1..350
AtPrx10 638 0 1..347 1..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3627917..3628186 270 N° 2 3627620..3627811 192 N° 3 3627369..3627534 166 N° 4 3626607..3627022 416
complement(join(3626607..3627022,3627369..3627534,3627620..3627811,3627917..3628 186))


exon

Literature and cross-references TsPrx10 (Thhalv10011619m)
DNA ref. Phytozome 12:   scaffold_7 (3628186..3626607)
Protein sequence: TsPrx10 (Thhalv10011619m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   348 (322)
PWM (Da):   %s   37643.8 (34609.3)  
PI (pH):   %s   6.39 (6.24) Peptide Signal:   %s   cut: 26 range:26-347
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDRKIFSFITHLAFFTLLFNDFVSSFPSGYNNGHGPHGYGLVSNLDYRFYDRSCPRLQMIVKTGVWKAFKDDSRIAASLLRLHFHDCFVNGCDGSILLEDSEDFKGEKNALPNRNSVRGFEVIEDIKSDIESSCPLTVSCADIVALAAREAVVLTGGPFWPVPLGRRDSLTASEQAANTNLPSPFEPLANITAKFVSLGLDLKDVVVLSGAHTIGFAQCFTFKHRLFNFKGSGQPDPNLAASSALISKLKNTCPNVDSSDSKLAALDAASAVKFDNAYYVNLMNNVGLLDSDQTLMTDSTAAALVKSYSENSYLFSRDFAISMVKMGNIGVMTGSDGVIRAKCGFPG*

Retrieve as FASTA  
Remarks Complete sequence fromm genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCGCAAAATCTTTTCGTTTATTACTCACCTAGCATTCTTTACCCTTCTCTTCAACGACTTCGTCTCCTCATTCCCTTCGGGATATAACAATGGTCACGGTCCTCACGGATACGGA
CTAGTTAGCAATCTCGACTATCGATTCTATGACCGGTCTTGTCCTCGTCTACAGATGATTGTTAAGACCGGAGTTTGGAAGGCTTTTAAAGACGATTCTAGAATCGCTGCCTCTCTTCTC
CGTCTCCATTTCCACGATTGTTTTGTCAAT
GTAAGTTACGCAACATTTGATTTTCATGTATATGGATATTATAAAAACATTTCATGCATATGGATATTATAAAAACATAAACACGTTATT
AAATTTTGTACGTAGGGTTGTGATGGCTCAATTCTTCTGGAGGACTCAGAGGATTTCAAAGGAGAGAAGAACGCTTTGCCAAACCGAAACTCAGTTCGTGGTTTCGAAGTCATCGAAGAC
ATCAAATCTGATATTGAAAGCTCTTGTCCCTTAACTGTTTCATGCGCGGACATAGTTGCTCTTGCAGCTAGAGAAGCCGTTGTCCTC
GTACGTGACGTGTGATCTTGAAACCGCTAATTA
TATTAATCTAAAATGTATCTAATGCATGCATGGCTTCTTATGCCATATGCAGACCGGAGGGCCGTTTTGGCCGGTGCCGTTGGGGAGACGGGACTCGTTGACGGCAAGTGAGCAAGCGGC
GAATACAAATCTGCCGTCACCGTTTGAGCCGTTGGCGAATATAACGGCCAAGTTCGTGTCCCTTGGACTCGACCTCAAAGATGTTGTTGTCCTCTCAG
GTTTGGTTAATTATCAACTTCC
AAGTTATATCAATATCAATAGTCAATACGAGTGTCAAATCCTACTATATAATTATTTTTTTTCTTATTATAATAGATGATGTTTCGGTTGAATGCACAATATAAATACCGTTTTTGCAAA
ATCAGCCAAATACTCATATATGAAAATAATAATCATAAAATTTACGGATTAAAAAGTAATTTCGAGATATAGATTTTTGTATTAACAACAAAAGAAAAACGTTATTTATTAATTATTAAA
ACAAAAAGAAGATGGTAAACCCAAGATATATTATTGATTCTTTTCGACTTATATTTTTATGACTTACACGTATGACGTATGTAGGGGCACATACTATAGGATTTGCTCAATGTTTCACGT
TCAAGCACAGGCTCTTCAACTTCAAGGGGTCAGGCCAGCCGGATCCGAACCTAGCCGCCTCCTCGGCTCTTATCTCTAAGCTAAAGAACACGTGTCCTAACGTGGACTCATCTGATTCTA
AGCTTGCTGCTCTTGACGCAGCTAGTGCCGTCAAGTTCGATAATGCTTACTACGTGAACCTAATGAACAACGTTGGACTGCTCGATTCCGACCAAACTCTAATGACGGATTCTACGGCTG
CTGCTTTGGTGAAGTCGTACAGCGAGAATTCGTACTTGTTCTCAAGGGATTTTGCGATTTCTATGGTTAAAATGGGGAATATTGGAGTTATGACCGGAAGTGATGGAGTTATTAGAGCAA
AATGTGGATTTCCAGGTTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCGCAAAATCTTTTCGTTTATTACTCACCTAGCATTCTTTACCCTTCTCTTCAACGACTTCGTCTCCTCATTCCCTTCGGGATATAACAATGGTCACGGTCCTCACGGATACGGA
CTAGTTAGCAATCTCGACTATCGATTCTATGACCGGTCTTGTCCTCGTCTACAGATGATTGTTAAGACCGGAGTTTGGAAGGCTTTTAAAGACGATTCTAGAATCGCTGCCTCTCTTCTC
CGTCTCCATTTCCACGATTGTTTTGTCAAT
GGTTGTGATGGCTCAATTCTTCTGGAGGACTCAGAGGATTTCAAAGGAGAGAAGAACGCTTTGCCAAACCGAAACTCAGTTCGTGGTTTC
GAAGTCATCGAAGACATCAAATCTGATATTGAAAGCTCTTGTCCCTTAACTGTTTCATGCGCGGACATAGTTGCTCTTGCAGCTAGAGAAGCCGTTGTCCTC
ACCGGAGGGCCGTTTTGG
CCGGTGCCGTTGGGGAGACGGGACTCGTTGACGGCAAGTGAGCAAGCGGCGAATACAAATCTGCCGTCACCGTTTGAGCCGTTGGCGAATATAACGGCCAAGTTCGTGTCCCTTGGACTC
GACCTCAAAGATGTTGTTGTCCTCTCAG
GGGCACATACTATAGGATTTGCTCAATGTTTCACGTTCAAGCACAGGCTCTTCAACTTCAAGGGGTCAGGCCAGCCGGATCCGAACCTAGCC
GCCTCCTCGGCTCTTATCTCTAAGCTAAAGAACACGTGTCCTAACGTGGACTCATCTGATTCTAAGCTTGCTGCTCTTGACGCAGCTAGTGCCGTCAAGTTCGATAATGCTTACTACGTG
AACCTAATGAACAACGTTGGACTGCTCGATTCCGACCAAACTCTAATGACGGATTCTACGGCTGCTGCTTTGGTGAAGTCGTACAGCGAGAATTCGTACTTGTTCTCAAGGGATTTTGCG
ATTTCTATGGTTAAAATGGGGAATATTGGAGTTATGACCGGAAGTGATGGAGTTATTAGAGCAAAATGTGGATTTCCAGGTTAA

Retrieve as FASTA