Entry information : TsPrx54 (Thhalv10013916m)
Entry ID 9769
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-24 (Christophe Dunand)
Peroxidase information: TsPrx54 (Thhalv10013916m)
Name (synonym) TsPrx54 (Thhalv10013916m)
Class Class III peroxidase    [Orthogroup: Prx005]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx54
start..stop
S start..stop
AruPrx54 645 0 1..361 1..358
AtPrx54 629 0 1..361 1..358
AlyPrx54 628 0 1..361 1..357
BstrPrx43 627 0 1..350 1..350
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2067283..2067519 237 N° 2 2066977..2067168 192 N° 3 2066709..2066874 166 N° 4 2066125..2066615 491
complement(join(2066125..2066615,2066709..2066874,2066977..2067168,2067283..2067 519))


exon

Literature and cross-references TsPrx54 (Thhalv10013916m)
DNA ref. Phytozome 12:   scaffold_2 (2067519..2066125)
Protein sequence: TsPrx54 (Thhalv10013916m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362
PWM (Da):   %s   37631.31 Transmb domain:   %s   i12-34o
PI (pH):   %s   4.12
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAARSSSTTCDGLFITSLLVIVSSILFGTSSAQLNATFYSGTCPNASAIVRSTIQQALQSDPRIGASLIRLHFHDCFVNGCDGSILLDDSGSIQSEKNAAPNANSARGFNVVDNIKTALENACPGIVSCSDVLALASEASVSLAGGPTWTVLLGRRDGLTANQAGANTSLPSPFEGLNNITSKFSAVGLNTTDLVALSGAHTFGRGNCVTFNNRLFNFNGTGNPDPTLNSTLLSSLQQICPQNGSGSGITNLDLSTPDAFDNNYFTNLQSNNGLLQSDQELFSDTGSPTIAIVTSFASNQTLFFEAFAQSMIKMGNISPLTGSSGEIRQDCKVINGQSATEAEDIQLQSDSDQEAVSLADM*

Retrieve as FASTA  
Remarks Complete sequence fromm genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCAAGAAGCTCGTCTACTACTTGTGATGGTTTGTTCATCACCAGCCTTCTCGTTATCGTTTCTTCAATATTGTTTGGGACATCCTCTGCGCAGTTAAACGCAACGTTTTACTCC
GGGACATGCCCTAACGCCTCTGCCATCGTTCGCAGCACCATTCAACAAGCTCTTCAATCAGACCCGAGAATCGGAGCCAGCCTAATCCGTCTTCATTTTCACGACTGCTTTGTTAAC
GTA
TAATTAATAATTAAGCTCTTAATTTAAATAAGCATCTCTTTTGTCGTAAGTAAGGCCTTCTGTATTTGTTACACTAAACCTCTCTACTTGGCTTCTTTACTTTTGAAAAAGGGTTGCGAC
GGGTCGATCTTGCTTGACGACAGTGGAAGCATCCAAAGCGAGAAGAATGCTGCCCCGAATGCAAACTCGGCAAGAGGATTCAACGTTGTCGATAATATCAAAACTGCCCTCGAGAATGCT
TGTCCCGGCATTGTCTCTTGCTCTGACGTTTTAGCCCTTGCCTCAGAGGCCTCTGTGTCTTTG
GTAATTAAAAAAAAAACTAACTGGCTAGTGACTACCATATGAAACATATGTTAATAA
TGATCACATTCATATATACAAACAAACATGTTTGATCATCTTCAGGCAGGAGGGCCTACATGGACTGTGTTGTTAGGAAGAAGAGATGGCCTCACGGCGAACCAGGCAGGGGCAAATACG
TCCCTTCCCTCTCCATTCGAAGGACTTAACAACATCACATCTAAATTTTCAGCTGTCGGCCTAAATACAACCGATCTTGTAGCCCTGTCTG
GTAAATATTAATCCACATATGTTTAGTTA
CTTGCGTCTCAATTCAAACAAAACCCTAGCTAATGCCAATTTTCTTGTGGTTTAATGTGCATAGGAGCGCATACGTTTGGACGTGGAAATTGTGTAACCTTCAACAATAGACTATTCAAC
TTCAACGGGACAGGTAATCCCGACCCGACTCTGAACTCGACACTTCTCAGCAGTCTTCAACAGATTTGCCCTCAAAACGGCAGCGGATCGGGTATCACCAATCTCGACCTGAGCACGCCT
GATGCGTTCGATAACAACTACTTCACCAACCTTCAGAGCAACAATGGTCTTCTGCAGTCCGACCAAGAACTGTTCTCTGATACTGGTTCACCCACCATCGCGATTGTTACTTCCTTTGCA
AGTAACCAAACTCTGTTTTTCGAGGCCTTTGCTCAGTCCATGATCAAAATGGGGAATATAAGTCCCTTGACGGGGAGTAGTGGAGAGATTAGACAAGATTGTAAGGTGATTAACGGACAG
TCAGCCACTGAAGCAGAGGACATTCAGTTACAGTCGGACTCGGATCAGGAAGCAGTGAGTTTAGCAGATATGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCAAGAAGCTCGTCTACTACTTGTGATGGTTTGTTCATCACCAGCCTTCTCGTTATCGTTTCTTCAATATTGTTTGGGACATCCTCTGCGCAGTTAAACGCAACGTTTTACTCC
GGGACATGCCCTAACGCCTCTGCCATCGTTCGCAGCACCATTCAACAAGCTCTTCAATCAGACCCGAGAATCGGAGCCAGCCTAATCCGTCTTCATTTTCACGACTGCTTTGTTAAC
GGT
TGCGACGGGTCGATCTTGCTTGACGACAGTGGAAGCATCCAAAGCGAGAAGAATGCTGCCCCGAATGCAAACTCGGCAAGAGGATTCAACGTTGTCGATAATATCAAAACTGCCCTCGAG
AATGCTTGTCCCGGCATTGTCTCTTGCTCTGACGTTTTAGCCCTTGCCTCAGAGGCCTCTGTGTCTTTG
GCAGGAGGGCCTACATGGACTGTGTTGTTAGGAAGAAGAGATGGCCTCACG
GCGAACCAGGCAGGGGCAAATACGTCCCTTCCCTCTCCATTCGAAGGACTTAACAACATCACATCTAAATTTTCAGCTGTCGGCCTAAATACAACCGATCTTGTAGCCCTGTCTG
GAGCG
CATACGTTTGGACGTGGAAATTGTGTAACCTTCAACAATAGACTATTCAACTTCAACGGGACAGGTAATCCCGACCCGACTCTGAACTCGACACTTCTCAGCAGTCTTCAACAGATTTGC
CCTCAAAACGGCAGCGGATCGGGTATCACCAATCTCGACCTGAGCACGCCTGATGCGTTCGATAACAACTACTTCACCAACCTTCAGAGCAACAATGGTCTTCTGCAGTCCGACCAAGAA
CTGTTCTCTGATACTGGTTCACCCACCATCGCGATTGTTACTTCCTTTGCAAGTAACCAAACTCTGTTTTTCGAGGCCTTTGCTCAGTCCATGATCAAAATGGGGAATATAAGTCCCTTG
ACGGGGAGTAGTGGAGAGATTAGACAAGATTGTAAGGTGATTAACGGACAGTCAGCCACTGAAGCAGAGGACATTCAGTTACAGTCGGACTCGGATCAGGAAGCAGTGAGTTTAGCAGAT
ATGTGA

Retrieve as FASTA