Entry information : TsPrx52 (Thhalv10014105m)
Entry ID 9777
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-21 (Christophe Dunand)
Peroxidase information: TsPrx52 (Thhalv10014105m)
Name (synonym) TsPrx52 (Thhalv10014105m)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx52
start..stop
S start..stop
BstrPrx47 612 0 1..324 1..324
AruPrx52 601 0 1..324 1..324
BoPrx52-1Cb_other 599 0 1..324 1..325
BnPrx52-2_other 598 0 1..324 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1538485..1538709 225 N° 2 1538155..1538346 192 N° 3 1537879..1538044 166 N° 4 1536865..1537256 392
complement(join(1536865..1537256,1537879..1538044,1538155..1538346,1538485..1538 709))


exon

Literature and cross-references TsPrx52 (Thhalv10014105m)
DNA ref. Phytozome 12:   scaffold_2 (1538709..1536865)
Protein sequence: TsPrx52 (Thhalv10014105m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (304)
PWM (Da):   %s   34219.08 (31952.7)  
PI (pH):   %s   8.58 (8.21) Peptide Signal:   %s   cut: 21 range:21-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASNKLIALLFLIVTLLLKGDNNNVVEAQLTTNFYSSSCPNLLSTVQTAVKSAVSSQNRMGASILRLFFHDCFVNGCDGSILLDDTSSFTGEQNANPNRNSARGFNVIDNIKSAVEKACPGVVSCADILAIAARDSVVILGGPNWNVKLGRRDARTASQAAANSNIPAPTSSLSQLISSFSAVGLSTRDMVALSGAHTIGQSRCTNFRARVYNETNINAAFATLRQRSCPRTAGSGDGNLAPLDVNSAASFDNSYFKNLMAQRGLLHSDQELFNGGSTDSIVRGYSNTPSSFSSDFAAAMIKMGDISPLTGTSGEIRKLCGRTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAAATAAACTTATTGCCCTTTTATTTCTCATCGTTACACTTTTATTGAAAGGTGATAACAATAACGTCGTCGAAGCACAACTCACGACAAATTTCTACTCAAGCTCTTGCCCT
AATCTTCTATCAACCGTCCAAACAGCCGTTAAATCTGCCGTCAGCAGCCAGAATCGGATGGGTGCATCTATCCTCCGTCTATTCTTTCACGATTGCTTCGTCAAC
GTAAGTTTTCTTACC
TCTTCTTTTACATTCCGTGCATCACAAGAAAAGTAGCGTGATGTTTTGTTTTTCTTTTCTTTTTGGTCTTTTTTTCTTCTAATCATATATTGTCATAACTTACAAATATATGTATGTATA
TAGGGATGCGACGGTTCGATTCTACTAGATGACACATCAAGCTTTACGGGAGAACAGAACGCGAACCCAAACCGGAATTCTGCTCGCGGGTTTAATGTGATCGACAACATCAAATCAGCG
GTTGAAAAAGCATGTCCCGGGGTTGTGTCTTGTGCTGATATCTTAGCCATTGCTGCTAGAGACTCCGTCGTAATC
GTAAGCCCCATATACAGTATCCTCTATTAGTCGGGTTTTGCATAT
ATTTAGTAGACTATATAAACCGGTAAAATAAAACAAATATTAATTCGTTCTTGTTCTGGTTGAAGCTTGGAGGGCCGAATTGGAATGTGAAGTTAGGAAGAAGAGATGCAAGAACGGCGA
GTCAAGCCGCAGCTAATAGTAACATTCCGGCACCGACTTCGAGTCTGAGCCAGCTTATTAGTAGTTTCAGTGCCGTTGGACTCTCCACCAGAGATATGGTTGCTCTCTCCG
GTCCGTTCA
TCGTTTCCTCTTATCCTTTTTTTCTGCCCAATGCTTAACTATTTTTTCCATAGACCAAGCTTGATTAAGGTAAAAAGTATAAAGCAACCAATGAATGAGCTTCCTTTTAAATCAATCGTT
TGATATTAAGATTCATTAATTGAATTTCTTTTTTTTTTTCAAATATCGGTAAAAACATTGCTAGCTACAAATCGGTGACAAACAAGTTTTTTTCTTCTCTAATCTGTGATTGTTCTTAAT
TTAGTATTGCTTACGTTTTCCCTTTCGCCAAATAGTTTTATATATTAAAAAAAAAAACGAAAATAGATGATGTTTCGAAGGACTAAAAGTAGTCAACAGATTCGACACAAAATTAAAATA
ATTGATTGTGTCTTTGAATTTTGTCGATTCATTTTTCTGCCACAATGAATTTTGACGATTCTTTCTTGTGTCTTTTGTGGTTTTTTCATATTTGTTACGCACCACCGACTTTTTTGTTTC
TTTGCCAAAGTTACTTTAACATATAGATTACTGTTACTCTACACCGACAAATTAATCCAATGATTATTAACTAATAGTAAATAATTATTAAGTCAACTAATAAACAAATTATTCTTTATA
TTTTTCTTTTCAGGAGCGCACACGATCGGGCAATCCCGTTGCACCAACTTCCGAGCGAGAGTGTACAACGAGACAAACATCAACGCCGCCTTCGCCACACTACGGCAGAGATCTTGCCCG
AGAACCGCCGGTTCCGGCGACGGAAACCTAGCTCCACTGGACGTAAACTCGGCGGCTTCATTCGACAACAGCTACTTCAAGAACCTAATGGCTCAGAGAGGTCTCCTCCATTCCGACCAA
GAACTCTTCAACGGCGGCTCCACCGACTCCATAGTCCGTGGATACAGCAACACTCCGTCGAGCTTCAGCTCCGATTTCGCGGCGGCGATGATCAAGATGGGTGATATTAGCCCCTTGACC
GGTACTAGCGGTGAGATCCGCAAGCTTTGCGGGAGGACCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAAATAAACTTATTGCCCTTTTATTTCTCATCGTTACACTTTTATTGAAAGGTGATAACAATAACGTCGTCGAAGCACAACTCACGACAAATTTCTACTCAAGCTCTTGCCCT
AATCTTCTATCAACCGTCCAAACAGCCGTTAAATCTGCCGTCAGCAGCCAGAATCGGATGGGTGCATCTATCCTCCGTCTATTCTTTCACGATTGCTTCGTCAAC
GGATGCGACGGTTCG
ATTCTACTAGATGACACATCAAGCTTTACGGGAGAACAGAACGCGAACCCAAACCGGAATTCTGCTCGCGGGTTTAATGTGATCGACAACATCAAATCAGCGGTTGAAAAAGCATGTCCC
GGGGTTGTGTCTTGTGCTGATATCTTAGCCATTGCTGCTAGAGACTCCGTCGTAATC
CTTGGAGGGCCGAATTGGAATGTGAAGTTAGGAAGAAGAGATGCAAGAACGGCGAGTCAAGCC
GCAGCTAATAGTAACATTCCGGCACCGACTTCGAGTCTGAGCCAGCTTATTAGTAGTTTCAGTGCCGTTGGACTCTCCACCAGAGATATGGTTGCTCTCTCCG
GAGCGCACACGATCGGG
CAATCCCGTTGCACCAACTTCCGAGCGAGAGTGTACAACGAGACAAACATCAACGCCGCCTTCGCCACACTACGGCAGAGATCTTGCCCGAGAACCGCCGGTTCCGGCGACGGAAACCTA
GCTCCACTGGACGTAAACTCGGCGGCTTCATTCGACAACAGCTACTTCAAGAACCTAATGGCTCAGAGAGGTCTCCTCCATTCCGACCAAGAACTCTTCAACGGCGGCTCCACCGACTCC
ATAGTCCGTGGATACAGCAACACTCCGTCGAGCTTCAGCTCCGATTTCGCGGCGGCGATGATCAAGATGGGTGATATTAGCCCCTTGACCGGTACTAGCGGTGAGATCCGCAAGCTTTGC
GGGAGGACCAACTGA

Retrieve as FASTA