Entry information : TsPrx66 (Thhalv10014117m)
Entry ID 9778
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-21 (Christophe Dunand)
Peroxidase information: TsPrx66 (Thhalv10014117m)
Name (synonym) TsPrx66 (Thhalv10014117m)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx66
start..stop
S start..stop
BrPrx66-1Aa_other 631 0 1..322 1..322
AtPrx66 621 0 1..322 1..322
BstrPrx29 616 0 1..322 1..322
AlyPrx66 615 0 1..322 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 13022508..13022720 213 N° 2 13022811..13022999 189 N° 3 13023080..13023646 567  
join(13022508..13022720,13022811..13022999,13023080..13023646)


exon

Literature and cross-references TsPrx66 (Thhalv10014117m)
Literature Taji,T., Sakurai,T., Mochida,K., Ishiwata,A., Kurotani,A., Totoki,Y., Toyoda,A., Sakaki,Y., Seki,M., Ono,H., Sakata,Y., Tanaka,S. and Shinozaki,K. BMC Plant Biol. 8, 115 (2008).
DNA ref. Phytozome 11:   scaffold_2 (13022508..13023646)
EST ref. GenBank:   BAJ33867
Protein sequence: TsPrx66 (Thhalv10014117m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (298)
PWM (Da):   %s   35615.14 (32823.7)  
PI (pH):   %s   9.5 (9.36) Peptide Signal:   %s   cut: 25 range:25-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFSKTLVFTMIFTVFAMVKPSEAALDAHYYDRSCPVAEKIILDTVRNATLYDPKVPARLLRMFFHDCFIRGCDASILLDSTRSNQAEKDGPPNISVRSFYVIEEAKTKLEKVCPRTVSCADVIAIAARDVVTLSGGPYWSVLKGRKDGTISRANETVNLPAPTFNVSQLIQSFAARGLSVKDMVTLSGGHTLGFSHCSSFEARLQNFSKFHDIDPSMNFAFAQTLKKKCPRSSNRGKNAGTVLDSTTSVFDNDYYKQILSGKGVFGSDQALLGDYRTKWIVETFARDQKAFFREFAASMVKLGNFGVKETGEVRVKSGFVN*

Retrieve as FASTA  
Remarks Complete sequence fromm genomic (introns 1 and 2) and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCTCGAAGACGCTCGTTTTCACGATGATCTTTACGGTTTTTGCGATGGTTAAGCCCTCAGAAGCTGCTCTTGATGCTCATTACTATGATCGATCGTGCCCCGTCGCAGAAAAA
ATCATTCTTGACACTGTTAGGAATGCAACTTTGTATGATCCCAAAGTGCCTGCTCGTCTCCTCAGAATGTTCTTCCACGATTGCTTCATCAGG
GTATGCATCTTCTTTTTTTAATCAATG
AGATATAAAGTTGATGATGATCGTTTTGAGTGTTGAGTAAATTGTTTGGTTGGGTTGTTATAGGGATGTGACGCATCGATTCTACTAGATTCAACACGGTCAAACCAAGCTGAGAAGGAT
GGTCCTCCAAACATCTCGGTACGATCATTCTACGTGATCGAAGAAGCTAAGACAAAGCTCGAAAAGGTTTGTCCTCGTACTGTGTCTTGTGCCGACGTAATCGCCATCGCAGCCAGAGAT
GTGGTCACCCTG
GTGAGTCTTCGTTGTAGAGTAGTCCCTTTATGGTCTACATGTAGTTTGCCTTCTAACTCGTAATATTGTTCATCTCTTAGTCCGGTGGTCCTTACTGGAGCGTACTTA
AAGGGCGAAAAGACGGGACGATTTCGCGGGCAAACGAGACAGTCAATCTCCCAGCACCAACATTCAACGTGTCTCAACTTATCCAAAGCTTTGCAGCAAGAGGCTTGTCAGTGAAAGACA
TGGTTACACTCTCTGGCGGCCACACGCTAGGGTTCTCTCACTGTTCTTCTTTCGAGGCTCGTCTTCAAAACTTCAGCAAATTCCACGACATTGACCCTTCGATGAACTTTGCATTTGCGC
AAACCCTCAAAAAGAAATGCCCGAGATCCTCTAACCGAGGCAAGAACGCAGGGACGGTCTTGGACTCTACAACCTCGGTTTTCGATAATGATTACTACAAGCAGATTTTGTCGGGGAAAG
GAGTGTTTGGGTCTGATCAGGCGCTTCTAGGAGATTACAGGACTAAGTGGATCGTTGAGACTTTTGCTCGAGACCAAAAGGCTTTCTTCAGAGAGTTTGCAGCTTCTATGGTGAAACTTG
GAAACTTTGGAGTCAAGGAAACGGGAGAAGTGAGAGTCAAGTCTGGCTTTGTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTTCTCGAAGACGCTCGTTTTCACGATGATCTTTACGGTTTTTGCGATGGTTAAGCCCTCAGAAGCTGCTCTTGATGCTCATTACTATGATCGATCGTGCCCCGTCGCAGAAAAA
ATCATTCTTGACACTGTTAGGAATGCAACTTTGTATGATCCCAAAGTGCCTGCTCGTCTCCTCAGAATGTTCTTCCACGATTGCTTCATCAGG
GGATGTGACGCATCGATTCTACTAGAT
TCAACACGGTCAAACCAAGCTGAGAAGGATGGTCCTCCAAACATCTCGGTACGATCATTCTACGTGATCGAAGAAGCTAAGACAAAGCTCGAAAAGGTTTGTCCTCGTACTGTGTCTTGT
GCCGACGTAATCGCCATCGCAGCCAGAGATGTGGTCACCCTG
TCCGGTGGTCCTTACTGGAGCGTACTTAAAGGGCGAAAAGACGGGACGATTTCGCGGGCAAACGAGACAGTCAATCTC
CCAGCACCAACATTCAACGTGTCTCAACTTATCCAAAGCTTTGCAGCAAGAGGCTTGTCAGTGAAAGACATGGTTACACTCTCTGGCGGCCACACGCTAGGGTTCTCTCACTGTTCTTCT
TTCGAGGCTCGTCTTCAAAACTTCAGCAAATTCCACGACATTGACCCTTCGATGAACTTTGCATTTGCGCAAACCCTCAAAAAGAAATGCCCGAGATCCTCTAACCGAGGCAAGAACGCA
GGGACGGTCTTGGACTCTACAACCTCGGTTTTCGATAATGATTACTACAAGCAGATTTTGTCGGGGAAAGGAGTGTTTGGGTCTGATCAGGCGCTTCTAGGAGATTACAGGACTAAGTGG
ATCGTTGAGACTTTTGCTCGAGACCAAAAGGCTTTCTTCAGAGAGTTTGCAGCTTCTATGGTGAAACTTGGAAACTTTGGAGTCAAGGAAACGGGAGAAGTGAGAGTCAAGTCTGGCTTT
GTCAATTAA

Retrieve as FASTA