Entry information : TsPrx57 (Thhalv10014171m)
Entry ID 9779
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-12-24 (Christophe Dunand)
Peroxidase information: TsPrx57 (Thhalv10014171m)
Name (synonym) TsPrx57 (Thhalv10014171m)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx57
start..stop
S start..stop
BrPrx57-1Aa_other 586 0 1..310 1..310
CagraPrx04 583 0 1..310 1..310
CrubPrx78 572 0 8..310 8..310
AtPrx57 567 0 3..310 6..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 6061329..6061526 198 N° 2 6060667..6061115 449 N° 3 6059958..6060243 286  
complement(join(6059958..6060243,6060667..6061115,6061329..6061526))


exon

Literature and cross-references TsPrx57 (Thhalv10014171m)
DNA ref. Phytozome 12:   scaffold_2 (6061526..6059958)
Protein sequence: TsPrx57 (Thhalv10014171m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   311 (291)
PWM (Da):   %s   33647.1 (31309.9) Transmb domain:   %s   i7-26o
PI (pH):   %s   10.5 (10.38) Peptide Signal:   %s   cut: 20 range:20-310
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MMKFSSLVVFFFIFPIAFAQLRVGFYSQSCPQAETIVRNLVRQRFGADPTVTAALLRMHFHDCFVRGCDASLLIDSTNSEKAAGPNGSVREFDLIDRIKAALEAACPSTVSCADIVTLATRDSVALAGGPSYSIPTGRRDGLVSNSADVALPGPTISVSGAVSFFTVKGMNVFDAVALMGAHTVGQANCGLFNDRITNFQGTGRPDPSMDPALVSSLRNTCASRGSAGLEQSTPLRFDNQFFKQIRKRRGVLQVDQRLSSDRQTRGVVARYANNNAFFKRQFARAMVKMGAVDVLTGRAGEIRRNCRRFN*

Retrieve as FASTA  
Remarks Complete sequence fromm genomic (introns 1 and 3'). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAAGTTTTCTTCTCTTGTTGTGTTTTTCTTTATTTTCCCAATCGCATTTGCTCAACTCCGAGTCGGGTTTTACAGCCAGTCATGCCCTCAAGCCGAGACTATCGTACGGAATTTG
GTGCGCCAGCGGTTTGGTGCTGACCCAACCGTCACTGCCGCTTTGCTCCGTATGCATTTCCACGATTGTTTCGTTAGG
GTAAGACTTTACTATAGCATTTTGATATGGCTCTAACATTTT
CAAACATCTAAACTTTTCGTTGATGAATATGTGGGAAAAATACGTTGTTGTATAAAATAAAATGTATATTTTTAGAAAATTTTCATAAAAATTAATTACACCAATTTCAGATCATATCAT
TTAGTCTGGTAGTTAAATTTTATATCAATAACGTTTACTCGTGCTTTGTAGGGATGCGATGCTTCGCTCCTTATAGACTCAACCAACTCTGAGAAAGCTGCCGGTCCAAACGGAAGCGTC
AGAGAATTTGACCTGATCGACCGCATCAAGGCTGCGCTAGAGGCCGCGTGTCCCTCCACGGTCTCATGTGCCGACATCGTAACATTAGCCACACGTGACTCGGTGGCATTAGCCGGAGGC
CCAAGCTACAGCATCCCCACGGGAAGGCGTGATGGTTTGGTCTCGAACAGTGCTGACGTGGCCCTACCTGGTCCAACCATCTCTGTCTCTGGAGCCGTCAGTTTCTTCACAGTCAAAGGG
ATGAACGTGTTCGATGCCGTGGCTCTTATGGGTGCACACACCGTTGGTCAAGCAAACTGTGGTCTGTTCAATGATCGCATCACTAACTTCCAAGGAACCGGACGACCTGACCCGTCCATG
GACCCCGCTTTGGTTTCCAG
GTAATTTTAAACCGGTTTGGTTCAATCAAACACCCACCAAATTCAAGACTGAATACTAATTTTAAAAGAACCTGAAATTTACTTTATACTTTGTTTAACT
CAATAGCTTTTGATTTTATATAAAAAAAAAAGTCAATTCTCTAACTTTTGAAATCTTCAAAACGTATCCAACTATATATATAATTGTCTTTTCATATATGACATTTTCAATGGTTGATAT
CATCTGAAGGAAAAGAAAAGGATATCTTTCAGTTAGTTAATTCCAAGAAGTTGGATTTTTAAGACATTGTTTCTAAGAAAGTTAGAAAACGAATTTCCCTATGAAACCCTAAGCAAATTA
GTTTCACATTCAATAAGCTTTTATTATTTTAACTCATCAGAATGATATTCTAAATGTTTTTTTTTTTTTTTGTAATGATGTAGCCTAAGGAACACATGTGCAAGCAGAGGTTCTGCGGGA
CTAGAGCAATCGACTCCATTGAGGTTCGACAACCAATTCTTCAAGCAGATCCGTAAAAGGAGAGGAGTGTTGCAAGTTGACCAAAGGCTCTCGTCAGACCGACAGACTCGTGGTGTTGTG
GCTCGATATGCAAACAACAATGCCTTCTTCAAGCGTCAGTTCGCTAGAGCAATGGTGAAGATGGGAGCCGTTGATGTGCTTACCGGTCGTGCCGGTGAGATCAGGAGAAATTGCAGGAGG
TTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATGAAGTTTTCTTCTCTTGTTGTGTTTTTCTTTATTTTCCCAATCGCATTTGCTCAACTCCGAGTCGGGTTTTACAGCCAGTCATGCCCTCAAGCCGAGACTATCGTACGGAATTTG
GTGCGCCAGCGGTTTGGTGCTGACCCAACCGTCACTGCCGCTTTGCTCCGTATGCATTTCCACGATTGTTTCGTTAGG
GGATGCGATGCTTCGCTCCTTATAGACTCAACCAACTCTGAG
AAAGCTGCCGGTCCAAACGGAAGCGTCAGAGAATTTGACCTGATCGACCGCATCAAGGCTGCGCTAGAGGCCGCGTGTCCCTCCACGGTCTCATGTGCCGACATCGTAACATTAGCCACA
CGTGACTCGGTGGCATTAGCCGGAGGCCCAAGCTACAGCATCCCCACGGGAAGGCGTGATGGTTTGGTCTCGAACAGTGCTGACGTGGCCCTACCTGGTCCAACCATCTCTGTCTCTGGA
GCCGTCAGTTTCTTCACAGTCAAAGGGATGAACGTGTTCGATGCCGTGGCTCTTATGGGTGCACACACCGTTGGTCAAGCAAACTGTGGTCTGTTCAATGATCGCATCACTAACTTCCAA
GGAACCGGACGACCTGACCCGTCCATGGACCCCGCTTTGGTTTCCAG
CCTAAGGAACACATGTGCAAGCAGAGGTTCTGCGGGACTAGAGCAATCGACTCCATTGAGGTTCGACAACCAA
TTCTTCAAGCAGATCCGTAAAAGGAGAGGAGTGTTGCAAGTTGACCAAAGGCTCTCGTCAGACCGACAGACTCGTGGTGTTGTGGCTCGATATGCAAACAACAATGCCTTCTTCAAGCGT
CAGTTCGCTAGAGCAATGGTGAAGATGGGAGCCGTTGATGTGCTTACCGGTCGTGCCGGTGAGATCAGGAGAAATTGCAGGAGGTTCAACTGA

Retrieve as FASTA