Entry information : TsPrx24 (Thhalv10016858m)
Entry ID 9783
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-27 (Christophe Dunand)
Peroxidase information: TsPrx24 (Thhalv10016858m)
Name (synonym) TsPrx24 (Thhalv10016858m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx24
start..stop
S start..stop
CagraPrx53 607 0 1..357 1..348
CrubPrx91 605 0 1..357 1..348
BrPrx24-1Aa_other 598 0 1..357 1..360
BstrPrx84 594 0 1..357 1..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 10012651..10012944 294 N° 2 10012343..10012537 195 N° 3 10012059..10012224 166 N° 4 10011126..10011544 419
complement(join(10011126..10011544,10012059..10012224,10012343..10012537,1001265 1..10012944))


exon

Literature and cross-references TsPrx24 (Thhalv10016858m)
DNA ref. Phytozome 12:   scaffold_10 (10012944..10011126)
Protein sequence: TsPrx24 (Thhalv10016858m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   358 (329)
PWM (Da):   %s   39062.28 (35850.4) Transmb domain:   %s   i7-26o
PI (pH):   %s   9.46 (9.45) Peptide Signal:   %s   cut: 29 range:29-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKNQLIVAIRFLFPLVLFLAVLLCVDGKRFSHNNGHQHDDHKIRRGRWEGKLKMKFYHKTCPEAEDIVREIVWKKVKANPSLSPKLLRVHYHDCFVRGCDASLLLDSVAGKAASEKEARPNLSLSGFEIIDEIKSILEKRCPKTVSCADILTLATRDAVSYQFGRPLWNVFTGRVDGKVSLATEAARDLPSAGANFTSLLKLFAESDLDVVDLVALSGAHTIGTARCGVFGRRLLNFTGKGDTDPSLNSSYASFLKSKCSDKSLRLNSSAVVGMDPTGALSFDSGYFFSLLQHKGLFTSDAALLTDRSAASIASAFQDSGSFLAQFGRSMIKMSSIKVLTLGDEGGEIRRNCRVVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAGAATCAGCTAATTGTAGCGATTCGGTTTTTATTTCCGCTTGTTTTGTTTTTAGCTGTTTTACTTTGTGTTGATGGTAAGAGATTCAGTCATAATAATGGTCATCAACATGAT
GACCATAAGATAAGAAGAGGAAGATGGGAGGGTAAGCTGAAGATGAAATTCTATCACAAGACCTGCCCTGAAGCCGAGGATATCGTGAGAGAGATTGTATGGAAAAAAGTCAAAGCTAAC
CCTAGCTTGTCTCCCAAGTTACTGAGAGTTCATTACCATGATTGCTTTGTTAGG
GTATGATAATAATCCTGAAGATCTAATATATTGCTCTAAAACGTTTCCTTTTCATTTCATGAACAT
TTTTTGTATTGAAGACAAGTCTAATGTAATTCACTGATCATATTCAGGGTTGCGACGCGTCGCTGCTTTTAGATTCAGTTGCTGGAAAAGCAGCATCCGAGAAGGAAGCGAGACCTAATC
TTTCGCTTTCCGGGTTCGAAATCATCGATGAGATCAAGTCCATTCTCGAAAAAAGATGCCCTAAAACCGTGTCTTGCGCAGACATTCTCACCCTAGCCACCCGAGACGCCGTCTCGTACC
AA
GTAATATACATAAACAATCTCATGTAGATATATATCATGATTGGAAAATATCATTTTTACTAATCAATCATGGGTAAATTTTATGGAAATGATGAATCCGGAACTTGATGTTATATAG

TTTGGAAGGCCGTTATGGAACGTTTTCACCGGACGTGTTGATGGAAAAGTTTCATTGGCGACGGAAGCCGCCAGAGACTTACCCTCCGCTGGTGCAAACTTCACCTCTCTACTGAAACTC
TTTGCCGAGAGCGATTTGGACGTCGTTGACCTCGTGGCTTTATCAG
GTTTTTTAGCATTTCTTTATTTTCTGTTTTTAATATTTTGGTAATCATATACACAATATTCATACGTTACTATT
AAGGTACCAAGTAAATTAAAAACCAACTTTATGAAGATCGCGGGAATATCAGACCACGTGCATGTCCATGTTACGAAGTTTATGGGAATGCTACAACGTTTTCTTCCAATATTCAAGAAG
TAGTATAATATCGTATATACTATGAAAAAAAAATATATATTTTGAACATCATATATTTGAGGAGATTAGGAGAATCATGGAAGAAACTTCCCACGTGGTCATTATTCGAGAATTTTCCAT
TAATTTTCTTAGAAATCATCTGATAATTAACTATTTATCACTTAAAACTTTTTATTTGTGTTGAATGCAAACAACTTTTTAAAGGCAAAATTTTAGTAATATTATATCATTTGCTGAGGA
ACTTTTTGAGATATATATCGTTGATAAAAGTTTGAGATGATTTTAAGCTAAATTAAAAGAAAAGAAAATGTATGAAACAGGAGCACACACAATAGGAACAGCACGTTGCGGTGTGTTTGG
TCGGAGACTCTTGAACTTCACCGGGAAAGGAGACACAGATCCTTCACTGAACTCTAGCTACGCTTCTTTCCTCAAATCCAAATGTTCCGACAAATCTCTAAGACTCAACTCTTCCGCAGT
GGTCGGAATGGACCCCACCGGAGCTCTCTCCTTTGATAGTGGCTACTTCTTCTCTCTCCTCCAACACAAAGGACTATTCACCTCCGACGCCGCCTTGTTGACTGATCGCTCCGCTGCTTC
CATTGCTAGTGCTTTCCAAGACTCCGGCAGTTTTCTTGCTCAGTTTGGTCGGTCTATGATCAAGATGAGTTCCATCAAAGTCCTTACACTTGGAGATGAAGGTGGTGAGATTCGCAGAAA
CTGTCGCGTTGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAAGAATCAGCTAATTGTAGCGATTCGGTTTTTATTTCCGCTTGTTTTGTTTTTAGCTGTTTTACTTTGTGTTGATGGTAAGAGATTCAGTCATAATAATGGTCATCAACATGAT
GACCATAAGATAAGAAGAGGAAGATGGGAGGGTAAGCTGAAGATGAAATTCTATCACAAGACCTGCCCTGAAGCCGAGGATATCGTGAGAGAGATTGTATGGAAAAAAGTCAAAGCTAAC
CCTAGCTTGTCTCCCAAGTTACTGAGAGTTCATTACCATGATTGCTTTGTTAGG
GGTTGCGACGCGTCGCTGCTTTTAGATTCAGTTGCTGGAAAAGCAGCATCCGAGAAGGAAGCGAGA
CCTAATCTTTCGCTTTCCGGGTTCGAAATCATCGATGAGATCAAGTCCATTCTCGAAAAAAGATGCCCTAAAACCGTGTCTTGCGCAGACATTCTCACCCTAGCCACCCGAGACGCCGTC
TCGTACCAA
TTTGGAAGGCCGTTATGGAACGTTTTCACCGGACGTGTTGATGGAAAAGTTTCATTGGCGACGGAAGCCGCCAGAGACTTACCCTCCGCTGGTGCAAACTTCACCTCTCTA
CTGAAACTCTTTGCCGAGAGCGATTTGGACGTCGTTGACCTCGTGGCTTTATCAG
GAGCACACACAATAGGAACAGCACGTTGCGGTGTGTTTGGTCGGAGACTCTTGAACTTCACCGGG
AAAGGAGACACAGATCCTTCACTGAACTCTAGCTACGCTTCTTTCCTCAAATCCAAATGTTCCGACAAATCTCTAAGACTCAACTCTTCCGCAGTGGTCGGAATGGACCCCACCGGAGCT
CTCTCCTTTGATAGTGGCTACTTCTTCTCTCTCCTCCAACACAAAGGACTATTCACCTCCGACGCCGCCTTGTTGACTGATCGCTCCGCTGCTTCCATTGCTAGTGCTTTCCAAGACTCC
GGCAGTTTTCTTGCTCAGTTTGGTCGGTCTATGATCAAGATGAGTTCCATCAAAGTCCTTACACTTGGAGATGAAGGTGGTGAGATTCGCAGAAACTGTCGCGTTGTCAACTAA

Retrieve as FASTA