Entry information : TsPrx19 (Thhalv10016874m)
Entry ID 9785
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-18 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-28 (Christophe Dunand)
Peroxidase information: TsPrx19 (Thhalv10016874m)
Name (synonym) TsPrx19 (Thhalv10016874m)
Class Class III peroxidase    [Orthogroup: Prx034]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx19
start..stop
S start..stop
BrPrx19-2Aa_other 621 0 1..348 1..348
AtPrx19 613 0 1..348 1..346
CrubPrx59 609 0 1..348 1..347
CagraPrx63 605 0 1..348 1..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7596274..7596540 267 N° 2 7596933..7597133 201 N° 3 7597409..7597987 579  
join(7596274..7596540,7596933..7597133,7597409..7597987)


exon

Literature and cross-references TsPrx19 (Thhalv10016874m)
DNA ref. Phytozome 12:   scaffold_10 (7596274..7597987)
Protein sequence: TsPrx19 (Thhalv10016874m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (328)
PWM (Da):   %s   38603.16 (36230.9) Transmb domain:   %s   i2-24o
PI (pH):   %s   9.79 (9.79) Peptide Signal:   %s   cut: 21 range:21-348
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MHVLSLTSSLIFLFLFSVSHIPIFPAKHTISPPPALRQRQQRELSSDYYSKKCPQLENLVGSVTSQRFKEVPISAPATIRLFFHDCFVEGCDGSILIETEKGSKTLAEREAEENKDLRKEGFESIIKAKALVESHCPSRVSCSDILAIATRDFIHLAGGPYYQVKKGRWDGKRSTATNVPPNIPRSNSTVDQLIKLFASKGLTVEDLVVLSGSHTIGFAHCKSFIGRLYDFKGTKRPDPNLDPRLIKELRMSCPFTGGSSGVSLPLDATTPFVFDNGYFRGLGTKLGLLGSDQALFLDPRTKPITLEMSKDKQRFLKAFGDAMDKMGSIGVKRGRKHGEIRTDCRVFL*

Retrieve as FASTA  
Remarks Complete sequence fromm genomic (introns 1 and 2 ). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATGTCTTATCTCTTACTTCCTCCTTAATATTCCTTTTCCTCTTTTCAGTATCACACATTCCGATATTTCCGGCGAAACACACAATCTCTCCACCTCCGGCACTGCGGCAGCGCCAG
CAAAGAGAGCTCTCCAGCGATTACTACTCTAAGAAATGTCCTCAGCTCGAAAATCTCGTCGGTTCCGTCACTTCTCAGCGGTTCAAAGAAGTACCCATCTCCGCTCCAGCCACTATTCGC
CTCTTCTTCCACGATTGCTTCGTTGAG
GTCAATTTTCTTTTTACCAAAATTTGTATTATCTTTCTTACGTCCTCAAGCGCACGATAGCACAAACCATTTATCGCAACAAGCATTTTTAGC
ATTACTAACCGGCATGGTCGAATTTCAATGCATCATCTCATTATGCCGCAATAATGATTGCAAAGTCAAAAACACCTACAATAGGCAAGTTCCAACGTAGCGCATTTTAGCAAAAGACGC
CAATATTCTGTTCATTTTAGTAACAAACTTAAAAAGTACTTTGGCTTGGTCTGTCTGTGTGTTTGTTTGATAATAGTATTATCATAATACTATATTACTACACATCACATGCATGCAAAC
AAATAAACTTGTTGATCGATTAACATAACTAAAGTGAGTTAAAAATTGGAAATTTGAAGGGTTGTGATGGGTCGATATTGATAGAAACAGAGAAAGGAAGCAAGACACTAGCAGAAAGAG
AAGCGGAAGAGAATAAGGATTTAAGAAAAGAAGGCTTTGAGAGTATCATCAAGGCAAAGGCATTGGTTGAGTCTCATTGCCCTTCTCGTGTCTCTTGTTCTGATATTCTCGCCATCGCTA
CTCGAGATTTCATCCACCTG
GTAATTAATAATCCCAATACTTTTAATACTTCCTATATTCATATAATTCGATACTAGCTAAACCGTTTCCTCTGGTTCTAGGACCGATTCTTACATGCCC
AAATGGTTCTAGGACCGTTTCAACTAAACCGGTTTTGGATATAGTTTTTGGCTTTGGTTCAACTTAATTATACTTGATTTTTAGTAACTTTGATTTTGAAAATGATTAAGATCGTTAATG
GTGTATGAATCTACGTGTCATTGACAAATATGCTTTGTGTTGACTCCGAAATTAGGCAGGTGGGCCCTACTATCAAGTAAAAAAAGGTAGGTGGGACGGTAAAAGATCAACGGCAACGAA
CGTCCCTCCAAACATACCTCGATCAAACTCCACCGTCGATCAGCTCATCAAGCTCTTCGCGTCCAAAGGACTAACCGTAGAGGATCTCGTCGTTCTTTCCGGGTCCCACACAATCGGTTT
CGCCCACTGCAAAAGCTTCATTGGTCGTCTCTACGACTTCAAAGGCACAAAACGACCCGACCCGAATCTCGACCCGAGATTAATCAAGGAGCTTCGTATGTCTTGCCCATTTACAGGTGG
AAGCTCCGGCGTCTCTCTTCCACTCGACGCCACAACTCCGTTTGTGTTCGACAACGGATATTTCAGAGGACTAGGAACTAAGCTGGGCCTTCTCGGGTCGGATCAAGCCCTGTTTCTTGA
CCCGAGGACGAAGCCCATTACGCTTGAGATGAGTAAAGATAAGCAGAGGTTTCTAAAGGCGTTTGGAGACGCTATGGATAAGATGGGTTCTATTGGTGTAAAGAGAGGAAGGAAACATGG
GGAGATACGAACAGATTGTCGTGTCTTTTTATAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCATGTCTTATCTCTTACTTCCTCCTTAATATTCCTTTTCCTCTTTTCAGTATCACACATTCCGATATTTCCGGCGAAACACACAATCTCTCCACCTCCGGCACTGCGGCAGCGCCAG
CAAAGAGAGCTCTCCAGCGATTACTACTCTAAGAAATGTCCTCAGCTCGAAAATCTCGTCGGTTCCGTCACTTCTCAGCGGTTCAAAGAAGTACCCATCTCCGCTCCAGCCACTATTCGC
CTCTTCTTCCACGATTGCTTCGTTGAG
GGTTGTGATGGGTCGATATTGATAGAAACAGAGAAAGGAAGCAAGACACTAGCAGAAAGAGAAGCGGAAGAGAATAAGGATTTAAGAAAAGAA
GGCTTTGAGAGTATCATCAAGGCAAAGGCATTGGTTGAGTCTCATTGCCCTTCTCGTGTCTCTTGTTCTGATATTCTCGCCATCGCTACTCGAGATTTCATCCACCTG
GCAGGTGGGCCC
TACTATCAAGTAAAAAAAGGTAGGTGGGACGGTAAAAGATCAACGGCAACGAACGTCCCTCCAAACATACCTCGATCAAACTCCACCGTCGATCAGCTCATCAAGCTCTTCGCGTCCAAA
GGACTAACCGTAGAGGATCTCGTCGTTCTTTCCGGGTCCCACACAATCGGTTTCGCCCACTGCAAAAGCTTCATTGGTCGTCTCTACGACTTCAAAGGCACAAAACGACCCGACCCGAAT
CTCGACCCGAGATTAATCAAGGAGCTTCGTATGTCTTGCCCATTTACAGGTGGAAGCTCCGGCGTCTCTCTTCCACTCGACGCCACAACTCCGTTTGTGTTCGACAACGGATATTTCAGA
GGACTAGGAACTAAGCTGGGCCTTCTCGGGTCGGATCAAGCCCTGTTTCTTGACCCGAGGACGAAGCCCATTACGCTTGAGATGAGTAAAGATAAGCAGAGGTTTCTAAAGGCGTTTGGA
GACGCTATGGATAAGATGGGTTCTATTGGTGTAAAGAGAGGAAGGAAACATGGGGAGATACGAACAGATTGTCGTGTCTTTTTATAG

Retrieve as FASTA