Entry information : SbPrx70 (Sobic.004G049800.1 [2.1] / Sb04g004250 [1.4])
Entry ID 979
Creation 2008-11-18 (Christophe Dunand)
Last sequence changes 2008-11-18 (Christophe Dunand)
Sequence status complete
Reviewer Messaoudi
Last annotation changes 2014-08-04 (Messaoudi)
Peroxidase information: SbPrx70 (Sobic.004G049800.1 [2.1] / Sb04g004250 [1.4])
Name (synonym) SbPrx70 (Sobic.004G049800.1 [2.1] / Sb04g004250 [1.4])
Class Class III peroxidase    [Orthogroup: Prx153]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Sorghum
Organism Sorghum bicolor    [TaxId: 4558 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SbPrx70
start..stop
S start..stop
ZmPrx27 591 0 14..352 1..342
SiPrx71 567 0 28..350 21..343
BdiPrx95 468 4e-167 15..350 6..344
OsPrx24 457 8e-163 4..352 3..347
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4050312..4050575 264 N° 2 4049992..4050183 192 N° 3 4049719..4049881 163 N° 4 4048295..4048734 440
complement(join(4048295..4048734,4049719..4049881,4049992..4050183,4050312..4050 575))


exon

Literature and cross-references SbPrx70 (Sobic.004G049800.1 [2.1] / Sb04g004250 [1.4])
Literature Cordonnier-Pratt,M.-M. et al., unpublished
DNA ref. Phytozome 12:   chromosome_4 (4050575..4048295)
Protein sequence: SbPrx70 (Sobic.004G049800.1 [2.1] / Sb04g004250 [1.4])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352
PWM (Da):   %s   37212.94 Transmb domain:   %s   i21-43o
PI (pH):   %s   8.4
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVSTRRRHSSSRMVAVPAPVVLGVAMVVVVLASSATGASGQLRMGFYAESCPGVERMVGDFVRQHVRRVPTVAAALLRLHFHDCFVRGCDASVLLNSTAGSVAEKDAPPNLTLRGFDFVDRVKTLVEEACPGVVSCADVLALAARDAVVAIGGPSWRVPTGRRDGTVSTMQEALNDIPKHTMTFQQLANLFASKGLGVRDLVWLSGAHTIGIAHCSSFADRLYGYPGAGAGNDTTDPSLDATYAANLRRRKCRAASGGYAEDAVVEMDPGSHLTFDLGYYRALLKHRGLLRSDAALLTDAAARADVESVVGGAEEVYFQVFARSMARLATVQVKTGAEGEIRRNCAVVNGG

Retrieve as FASTA  
Remarks Complete sequence from genomic (chromo 4, 3 introns)and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTGAGCACCAGGAGGCGGCACAGCAGCAGCAGGATGGTGGCCGTGCCGGCGCCGGTGGTTCTTGGAGTGGCCATGGTCGTCGTCGTCCTGGCCAGCAGCGCGACCGGCGCGAGC
GGGCAGCTGAGGATGGGGTTCTACGCCGAGAGCTGCCCCGGCGTGGAGCGAATGGTGGGCGACTTCGTCCGGCAGCACGTCCGCCGCGTGCCCACCGTCGCCGCCGCGCTGCTCCGGCTG
CACTTCCACGACTGCTTCGTCAGG
GTACGTGACTACGCGCGTTGTTGTGTCCATTGCACGGCGGCGTGCCGGTGCCAGCTGACTGCCAGTGCGCGCACTGACCGTGTGGGTGTGCATGAT
GTGCATGTGTTCCACTGTCGTCGTCCCGCCAGGGCTGCGACGCCTCCGTCCTGCTCAACTCCACCGCCGGCAGCGTGGCCGAGAAGGACGCGCCGCCGAACCTGACGCTGCGCGGCTTCG
ACTTCGTCGACCGCGTCAAGACGCTCGTCGAGGAGGCCTGCCCAGGCGTCGTCTCCTGCGCCGACGTCCTCGCGCTCGCCGCCCGGGACGCGGTCGTCGCCATT
GTGCGTGAGCTCACCA
TTCCACCACTAGTTTCTCTGGTGCCTGGACGATGGATCATCGACCATGCATGAGCTGACAATCCAAGTGCTCGATCGATCGGACTTGTTGGCAGGGTGGGCCGTCGTGGCGCGTGCCGAC
GGGGAGGAGGGACGGCACGGTGTCGACCATGCAGGAGGCGCTCAACGACATCCCCAAGCACACCATGACCTTCCAGCAGCTGGCCAACCTGTTCGCCAGCAAAGGCCTCGGCGTCCGTGA
CCTCGTCTGGCTCTCAG
GTGCCCACCTCGATCTACATGACTAATCTCCTCTTCACATGCATGGCAGTAACAAATAAACGAAACATTTGTCACTACTACATTTGTATTTTTTACTCCTTAA
GTACATATCAGTAAAAAAGATTAGGGGGATTATTCCTGTAACTAGATCAAACGTGAATTTCACAAAAGTTCGATTGTCACAGAAAGCAGACTGGTGTGGTTCAGACTTCAGATAGGCGTA
GTAGGCCGGACACTGAGCTGAGATAGCCTGGTTCTGATTGCCCATTCCTTACATGTTGATTGGGCAACAACAGTACATGCAAAAGCAGCACGAATAATGGTTTGCTTTCGCTGCCCTTCT
TAAACCGGATCGCCAGATTCCTTGAGCGAAATGTTCCAAATTTTACTTTCAGCTCCGATCCACTCATGCCTGCTAGCTTCGTTCCTGTCCTCTCGATACGTCCGCATCAGATGCTCCTTT
CACTATATATTTCATAATATAGCTGAGCACTCACCATTCCTGATTCCTCTCAAATGAAATTCCTGAACTAAAGCTGTTTTTTTTTTTTGTGAGGAAGCCGGGAGGGAGGCCCCTACCTAA
ATTGTATTAAAAATGCAAACTGTACAAATGTAGGTGCAAAGCCACATAAGGCTCAGAGAGAAAAAAAAGAAGATAAAATACAAAAGGGAAGAATAAGAACAGAAAAGCAGCTGAACTAAA
GCTGTTCTTGAATTTAGTTTTTTTTCTTACATAGAAAACAGTGCAGCCCGCCAAAATTGTGACTGTGCATAGGTCACTACATTAACTTGTCCATTTTTACTGTTTTTTCCTCCAAGAAAT
CAAACTGTTCATCAGCATTTCAGCAACATGAAAATCAGCTGTAAAAATGAATAGAGACAAGTGCTCAAATCTTGCATGCAGTTCAGGCTGTTTTGTAGTCGTTGTACTCTCCGTCGTCCA
CCATTTGTTTTCTGACATGTGGAATGCGACTGATCGAGCAGGCGCGCACACGATCGGCATCGCGCACTGCTCCTCCTTCGCCGACCGCCTCTACGGCTACCCCGGCGCCGGCGCCGGCAA
CGACACGACGGACCCGTCCCTGGACGCGACCTACGCCGCCAACCTCCGCCGGCGCAAGTGCCGGGCGGCGAGCGGCGGGTACGCCGAGGACGCCGTGGTGGAGATGGACCCGGGCAGCCA
CCTGACGTTCGACCTGGGCTACTACCGCGCGCTGCTCAAGCACAGGGGCCTGCTCCGCTCCGACGCCGCGCTGCTCACCGACGCGGCGGCGCGCGCCGACGTCGAGAGCGTCGTGGGCGG
CGCCGAGGAGGTCTACTTCCAGGTGTTCGCGCGGTCCATGGCCAGGCTCGCGACGGTGCAGGTCAAGACCGGAGCTGAGGGGGAGATCAGGAGGAACTGCGCCGTCGTGAACGGCGGCTA
G

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTGAGCACCAGGAGGCGGCACAGCAGCAGCAGGATGGTGGCCGTGCCGGCGCCGGTGGTTCTTGGAGTGGCCATGGTCGTCGTCGTCCTGGCCAGCAGCGCGACCGGCGCGAGC
GGGCAGCTGAGGATGGGGTTCTACGCCGAGAGCTGCCCCGGCGTGGAGCGAATGGTGGGCGACTTCGTCCGGCAGCACGTCCGCCGCGTGCCCACCGTCGCCGCCGCGCTGCTCCGGCTG
CACTTCCACGACTGCTTCGTCAGG
GGCTGCGACGCCTCCGTCCTGCTCAACTCCACCGCCGGCAGCGTGGCCGAGAAGGACGCGCCGCCGAACCTGACGCTGCGCGGCTTCGACTTCGTC
GACCGCGTCAAGACGCTCGTCGAGGAGGCCTGCCCAGGCGTCGTCTCCTGCGCCGACGTCCTCGCGCTCGCCGCCCGGGACGCGGTCGTCGCCATT
GGTGGGCCGTCGTGGCGCGTGCCG
ACGGGGAGGAGGGACGGCACGGTGTCGACCATGCAGGAGGCGCTCAACGACATCCCCAAGCACACCATGACCTTCCAGCAGCTGGCCAACCTGTTCGCCAGCAAAGGCCTCGGCGTCCGT
GACCTCGTCTGGCTCTCAG
GCGCGCACACGATCGGCATCGCGCACTGCTCCTCCTTCGCCGACCGCCTCTACGGCTACCCCGGCGCCGGCGCCGGCAACGACACGACGGACCCGTCCCTG
GACGCGACCTACGCCGCCAACCTCCGCCGGCGCAAGTGCCGGGCGGCGAGCGGCGGGTACGCCGAGGACGCCGTGGTGGAGATGGACCCGGGCAGCCACCTGACGTTCGACCTGGGCTAC
TACCGCGCGCTGCTCAAGCACAGGGGCCTGCTCCGCTCCGACGCCGCGCTGCTCACCGACGCGGCGGCGCGCGCCGACGTCGAGAGCGTCGTGGGCGGCGCCGAGGAGGTCTACTTCCAG
GTGTTCGCGCGGTCCATGGCCAGGCTCGCGACGGTGCAGGTCAAGACCGGAGCTGAGGGGGAGATCAGGAGGAACTGCGCCGTCGTGAACGGCGGCTAG

Retrieve as FASTA