Entry information : TsPrx29 (Thhalv10021081m)
Entry ID 9795
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-30 (Christophe Dunand)
Peroxidase information: TsPrx29 (Thhalv10021081m)
Name (synonym) TsPrx29 (Thhalv10021081m)
Class Class III peroxidase    [Orthogroup: Prx039]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx29
start..stop
S start..stop
BrPrx29-1Aa_other 630 0 1..339 1..336
AhalPrx23 608 0 1..339 1..338
AtPrx29 607 0 1..339 1..338
BstrPrx17 603 0 1..339 1..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3516530..3516778 249 N° 2 3515327..3515690 364 N° 3 3514704..3515110 407  
complement(join(3514704..3515110,3515327..3515690,3516530..3516778))


exon

Literature and cross-references TsPrx29 (Thhalv10021081m)
DNA ref. Phytozome 12:   scaffold_13 (3516778..3514704)
Protein sequence: TsPrx29 (Thhalv10021081m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340 (311)
PWM (Da):   %s   36682.04 (33756.5)  
PI (pH):   %s   4.67 (4.42) Peptide Signal:   %s   cut: 29 range:29-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKPKSKAAASASCFLVMVISLLCSCISGDQMETNYEGLSYNYYEKTCPKLEDIVRSSISPMFILDPTSPSALLRLMFHDCQVQGCDASILIEPSGDQNQFTEIYSAKNFGIRKRELIGSIKTSLEAECPNQVSCSDIIILAAREAVALTGGPLISVPLGRKDSLSTPSKHVADSELPPSTADVDTILSLFAGMAMTVEESVAIMGSHTLGVTHCNNVLSRFDNANGTNANMDPRFETFLRVVCPEFSPSSKTAEATFVPNDQTSLTFDTAYYDDAIAGRGNLRIDSEIGADPRTRPFVEAFAADQDRFFNAFSSAFVKLSSYKVLTGNNGVVRSVCDKV*

Retrieve as FASTA  
Remarks Complete sequence fromm genomic (introns 1 and 3). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCAAAGAGCAAAGCTGCAGCTTCTGCATCGTGTTTTCTTGTCATGGTCATCAGTTTGTTATGTAGCTGCATTAGTGGCGATCAAATGGAAACTAATTATGAAGGCTTATCTTAC
AATTACTACGAGAAAACATGTCCAAAACTCGAAGATATCGTGAGATCTTCGATTTCACCAATGTTTATACTTGATCCTACGTCTCCTTCAGCCTTGCTTAGGCTTATGTTTCATGACTGC
CAAGTTCAG
GTTCTCTATCTCTACATACCTCCATATCTCTCTAAAATATTCTCAATTATGGCTTTGTTTTTAACTCAAAAGGGTTTAGTTTACAAAAGGTGCTTATTTATCATCTTAAGG
ATTTGATTTACACTATTGAGTGAATTAACAACACGAATGCGGTAATGTCGTCTTTAAAGTATGCCAAACTTGGATATTGGTAATCTCTATTTTCTAATATATTTTCTGACATGAATTTTA
TTTTATTTTCTTTTAACCAAAAGATTTTTTTTTATTTTGGTTCTATATAAACGAACAAAATTTGAGATGTTTTCTATATGAACGTATATTGTTGTTAATGTAGTTAATTTATTGGGTTTT
GCATGTCATCCATAAATTTGAGAAGGACAACAAGGCGCGGAAAAGTTGCTAAGACCACTTTAAGTAGTTAAACACGTCACGGTCCATTGTGGACTATATATAGGAAGCATGAAGTAACTT
TTGCCATGTTAATGCGCGTCATATCATAAAATCATTTATAATAATGGTATTGTAACTAGATTTAATTTATAGCTTAGGCTAAATAGTAAAACCATTTTCACTAATCGGATACATAGAAGA
AGAAGAAAATGACAAGGATCAGTTGATTTGGTCGAGAGTCTTGAATATATTATACAATCCCTTAATTTTAATTTAATCTAGCGATCCATTAAACTTAAACTACGTACATTCATGAGAATC
AAATAGTTTTGTATTTGTACAAGTCACAATTTCGATAGTATTTTAGAGAGATCTAAAAAAAACTAAACTACGAATTTACTGCATCTCATTAAATTGTCGGGGAACAAATGGCTACTGCAT
TTTCACAGGGCTGTGACGCATCGATCCTAATCGAGCCAAGTGGGGACCAGAACCAGTTCACAGAGATCTATTCAGCCAAGAACTTCGGAATCAGAAAGAGGGAACTGATTGGCTCAATCA
AAACCTCACTGGAAGCCGAGTGTCCCAACCAAGTCTCTTGCTCTGATATCATCATCCTCGCCGCAAGAGAAGCCGTCGCTCTCACGGGTGGTCCACTCATCTCCGTGCCATTAGGAAGAA
AAGACTCTCTCTCCACTCCTAGCAAACACGTGGCTGACTCTGAGCTTCCTCCCTCCACTGCTGACGTGGACACTATCTTAAGTCTTTTTGCTGGCATGGCCATGACCGTCGAAGAGTCCG
TCGCCATTATGG
GTATACTATACAACATCATCTATTTTCTTATATTCTTACAAGACTTTATCACTTTATATATCTATCCTGCATGGGCTTAATTATCTTATGTATAACGAATTATTGGGT
TTGCATTTTTATTTCTTATAATAATAAGTAATAAGACTTTTGGATCATGCATATTTTTTTCATATAATTGATAGCACTTGCTTTTGTTTTTCTTTTGTTTGCATGCAGGTTCACATACTT
TAGGAGTTACACATTGCAACAACGTACTATCGCGTTTCGATAACGCAAACGGGACGAACGCTAACATGGATCCACGTTTTGAAACGTTTTTGCGAGTTGTATGCCCAGAATTTTCTCCAT
CCTCCAAAACTGCGGAAGCTACATTTGTTCCAAACGATCAAACTTCGTTGACCTTCGACACGGCTTATTACGATGATGCCATAGCGGGTCGTGGCAATCTCAGAATCGACTCGGAGATTG
GAGCCGACCCACGTACACGCCCTTTTGTAGAAGCGTTTGCGGCTGATCAGGATCGTTTCTTCAACGCTTTCTCTTCTGCGTTTGTAAAATTGTCTTCTTACAAGGTGTTAACCGGGAATA
ATGGAGTGGTTAGAAGCGTGTGTGACAAGGTTTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAACCAAAGAGCAAAGCTGCAGCTTCTGCATCGTGTTTTCTTGTCATGGTCATCAGTTTGTTATGTAGCTGCATTAGTGGCGATCAAATGGAAACTAATTATGAAGGCTTATCTTAC
AATTACTACGAGAAAACATGTCCAAAACTCGAAGATATCGTGAGATCTTCGATTTCACCAATGTTTATACTTGATCCTACGTCTCCTTCAGCCTTGCTTAGGCTTATGTTTCATGACTGC
CAAGTTCAG
GGCTGTGACGCATCGATCCTAATCGAGCCAAGTGGGGACCAGAACCAGTTCACAGAGATCTATTCAGCCAAGAACTTCGGAATCAGAAAGAGGGAACTGATTGGCTCAATC
AAAACCTCACTGGAAGCCGAGTGTCCCAACCAAGTCTCTTGCTCTGATATCATCATCCTCGCCGCAAGAGAAGCCGTCGCTCTCACGGGTGGTCCACTCATCTCCGTGCCATTAGGAAGA
AAAGACTCTCTCTCCACTCCTAGCAAACACGTGGCTGACTCTGAGCTTCCTCCCTCCACTGCTGACGTGGACACTATCTTAAGTCTTTTTGCTGGCATGGCCATGACCGTCGAAGAGTCC
GTCGCCATTATGG
GTTCACATACTTTAGGAGTTACACATTGCAACAACGTACTATCGCGTTTCGATAACGCAAACGGGACGAACGCTAACATGGATCCACGTTTTGAAACGTTTTTGCGA
GTTGTATGCCCAGAATTTTCTCCATCCTCCAAAACTGCGGAAGCTACATTTGTTCCAAACGATCAAACTTCGTTGACCTTCGACACGGCTTATTACGATGATGCCATAGCGGGTCGTGGC
AATCTCAGAATCGACTCGGAGATTGGAGCCGACCCACGTACACGCCCTTTTGTAGAAGCGTTTGCGGCTGATCAGGATCGTTTCTTCAACGCTTTCTCTTCTGCGTTTGTAAAATTGTCT
TCTTACAAGGTGTTAACCGGGAATAATGGAGTGGTTAGAAGCGTGTGTGACAAGGTTTAG

Retrieve as FASTA