Entry information : TsPrx27 (Thhalv10021152m)
Entry ID 9797
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-30 (Christophe Dunand)
Peroxidase information: TsPrx27 (Thhalv10021152m)
Name (synonym) TsPrx27 (Thhalv10021152m)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx27
start..stop
S start..stop
BrPrx27-1Aa_other 609 0 1..321 1..319
BrPrx27-1Ab_other 603 0 1..321 1..319
BnPrx27-1_other 602 0 1..321 1..319
BstrPrx44 597 0 1..321 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 9155197..9155409 213 N° 2 9154924..9155109 186 N° 3 9154664..9154823 160 N° 4 9154104..9154510 407
complement(join(9154104..9154510,9154664..9154823,9154924..9155109,9155197..9155 409))


exon

Literature and cross-references TsPrx27 (Thhalv10021152m)
DNA ref. Phytozome 12:   scaffold_13 (9155409..9154104)
Protein sequence: TsPrx27 (Thhalv10021152m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (298)
PWM (Da):   %s   35092.94 (32549.6) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.41 (8.39) Peptide Signal:   %s   cut: 24 range:24-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAACKRLVVSCLFLVLLLAEANAQGLKVGFYGKTCPEAEGIVRKIVFAAMKKAPTLGAPLLRMFFHDCFVRGCDGSVLLELSNKQDEKNAVPNLSLRGFGIIDDSKAALEKVCPGIVSCSDILALVARDAMVALEGPSWEVETGRRDGRVSNINEVILPSPFDNIAKLITDFRSKGLDEKDLVVLSGGHTIGMGHCPLMSNRLYNFTGRGDSDPSLDSEYAANLRKKCKPTDTTTALEMDPGSFKTFDESYFTLVAKRRGLFQSDAALLDNSKTRAYVFQQARTHGSTFFHDFGVSMVKMGRIEVLTGRAGEIRKMCRVPN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCATGTAAGCGATTGGTTGTCTCTTGCTTGTTCTTAGTGTTGTTGCTAGCTGAAGCCAATGCACAAGGCTTGAAAGTAGGTTTCTACGGCAAAACATGCCCTGAAGCCGAGGGT
ATTGTTAGAAAGATAGTGTTCGCTGCGATGAAGAAAGCGCCTACGCTTGGTGCTCCTTTGCTTAGAATGTTCTTCCACGACTGCTTCGTTCGG
GTATGTTTCTCAAATGGCTCATGACTT
TTAAATATATACACTTCTTTATTATGTCTCGTCTTATATTGAGTGAATCGTACTCAACAGGGATGTGACGGATCAGTTTTGTTAGAGCTATCGAACAAACAAGATGAGAAGAATGCAGTT
CCTAACCTAAGTCTTCGAGGGTTTGGAATCATAGACGATTCCAAGGCGGCTCTTGAAAAAGTGTGTCCGGGCATTGTTTCTTGCTCTGATATCTTAGCCCTTGTCGCTAGGGACGCAATG
GTTGCA
GTAAGTAATATATCTTCGCATTAATCCGAGAATTTTATATATACATGTAGGGAGCTCCTTGAATTCACTTTGAATATATATGCCGGTTGATTTTAATTAGCTTGAGGGACCATC
ATGGGAAGTGGAAACGGGAAGAAGAGACGGTAGGGTTTCTAATATCAATGAGGTCATCTTGCCATCACCTTTTGACAACATCGCCAAGCTTATCACCGATTTTCGCTCAAAGGGACTAGA
CGAGAAAGATCTAGTCGTTCTTTCAG
GTACGTATTTACAAATGAACGATATTGGTCTGAAATAATATTTGAATTCAAGAAATGGATTAATTAGCTAGAAACCCGTTTTGGTAGTAAATAT
AAAATGTTGATAGATGGAAAAATATACATAATTTTTTGTTTGTATCTTCTAAATAAAAGGTGGACACACTATTGGAATGGGACATTGTCCCCTAATGTCAAACCGGCTTTACAACTTCAC
CGGAAGAGGAGACAGCGACCCGAGTTTGGACTCGGAGTACGCCGCTAACCTCAGGAAGAAATGCAAGCCGACGGATACCACGACGGCTCTAGAGATGGATCCGGGAAGTTTCAAGACATT
CGACGAGAGCTACTTCACGCTAGTGGCTAAGAGAAGAGGGCTTTTCCAATCGGATGCTGCTCTATTGGACAACTCAAAGACAAGGGCTTATGTCTTCCAGCAGGCAAGAACTCATGGGTC
AACCTTCTTCCATGACTTTGGTGTCTCGATGGTGAAAATGGGTCGGATCGAAGTTCTTACGGGTCGGGCCGGGGAGATCCGTAAGATGTGTCGTGTTCCTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCATGTAAGCGATTGGTTGTCTCTTGCTTGTTCTTAGTGTTGTTGCTAGCTGAAGCCAATGCACAAGGCTTGAAAGTAGGTTTCTACGGCAAAACATGCCCTGAAGCCGAGGGT
ATTGTTAGAAAGATAGTGTTCGCTGCGATGAAGAAAGCGCCTACGCTTGGTGCTCCTTTGCTTAGAATGTTCTTCCACGACTGCTTCGTTCGG
GGATGTGACGGATCAGTTTTGTTAGAG
CTATCGAACAAACAAGATGAGAAGAATGCAGTTCCTAACCTAAGTCTTCGAGGGTTTGGAATCATAGACGATTCCAAGGCGGCTCTTGAAAAAGTGTGTCCGGGCATTGTTTCTTGCTCT
GATATCTTAGCCCTTGTCGCTAGGGACGCAATGGTTGCA
CTTGAGGGACCATCATGGGAAGTGGAAACGGGAAGAAGAGACGGTAGGGTTTCTAATATCAATGAGGTCATCTTGCCATCA
CCTTTTGACAACATCGCCAAGCTTATCACCGATTTTCGCTCAAAGGGACTAGACGAGAAAGATCTAGTCGTTCTTTCAG
GTGGACACACTATTGGAATGGGACATTGTCCCCTAATGTCA
AACCGGCTTTACAACTTCACCGGAAGAGGAGACAGCGACCCGAGTTTGGACTCGGAGTACGCCGCTAACCTCAGGAAGAAATGCAAGCCGACGGATACCACGACGGCTCTAGAGATGGAT
CCGGGAAGTTTCAAGACATTCGACGAGAGCTACTTCACGCTAGTGGCTAAGAGAAGAGGGCTTTTCCAATCGGATGCTGCTCTATTGGACAACTCAAAGACAAGGGCTTATGTCTTCCAG
CAGGCAAGAACTCATGGGTCAACCTTCTTCCATGACTTTGGTGTCTCGATGGTGAAAATGGGTCGGATCGAAGTTCTTACGGGTCGGGCCGGGGAGATCCGTAAGATGTGTCGTGTTCCT
AATTAA

Retrieve as FASTA