Entry information : TsPrx18 (Thhalv10000495m)
Entry ID 9800
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-30 (Christophe Dunand)
Peroxidase information: TsPrx18 (Thhalv10000495m)
Name (synonym) TsPrx18 (Thhalv10000495m)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx18
start..stop
S start..stop
BrPrx18-1Aa_other 578 0 1..329 5..333
BnPrx18-1_other 575 0 2..329 6..333
AlyPrx18 574 0 1..329 5..329
BstrPrx63 571 0 1..329 5..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4211097..4211324 228 N° 2 4210818..4210997 180 N° 3 4210318..4210483 166 N° 4 4209818..4210233 416
complement(join(4209818..4210233,4210318..4210483,4210818..4210997,4211097..4211 324))


exon

Literature and cross-references TsPrx18 (Thhalv10000495m)
DNA ref. Phytozome 12:   scaffold_15 (4211324..4209818)
Protein sequence: TsPrx18 (Thhalv10000495m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (300)
PWM (Da):   %s   35706.79 (32558.1) Transmb domain:   %s   i7-29o
PI (pH):   %s   4.66 (4.59) Peptide Signal:   %s   cut: 30 range:30-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASCTQKSTFLSPILVFLALLLLLSSSVADLSFNFYAGSCPGAEFIVRNTVRSASTTDPSILGKLLRLIFHDCFVQGCDASVLIRGNGTERSDPGNASLGGFTVIESAKNVLEIFCPGIVSCADILVLAARDAVEALGGPVVAVPTGRRDGTVSLAENVRPNIIDTDFTVDKMITVFSSKGLSVQDLVVLSGAHTIGAAHCNTFNSRFKRDPNGNFELIDASLDNNYAQTLMNKCSSSMDPTTTVVNNDPETSSTFDNQYYRNLQAHKGLFQTDSALMEDERTRKIVEILANDEEIFFERWSESFVKMSVMGVRVGEEGEIRRSCSFVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTGTACACAAAAATCTACATTCCTCTCACCTATTCTCGTTTTCCTTGCTCTACTTCTGCTTCTTTCTTCTTCAGTAGCTGACCTCTCTTTCAACTTCTACGCTGGTTCTTGT
CCCGGAGCAGAGTTCATCGTCAGGAACACCGTGAGATCGGCTTCAACCACTGATCCATCAATTCTTGGGAAGCTCCTCCGTCTCATCTTCCATGATTGTTTCGTGCAG
GCATGTTACTAC
ACTGCAAAACATGATTGGTTACTACACTGCAAAACATGATTGGTCCTTCTAATTCTTTGATTACAAAATGAGAGATTTTTGTCTCAGGGTTGCGATGCATCAGTGTTGATTCGAGGGAAC
GGTACAGAGAGAAGCGATCCAGGGAATGCGTCTCTGGGAGGATTCACTGTGATAGAAAGCGCCAAAAATGTCCTCGAAATCTTCTGTCCAGGCATAGTCTCTTGCGCTGATATCCTTGTT
CTTGCTGCTAGAGACGCTGTAGAAGCT
GTAAGAATTTTCATCAAATTCACATACATATGAAATCTACATATCTCTATCTTTCAAACCAATTTTTTGCTTAAAAACTCGGTTTCTTGTTGT
GCACAAAAAGTCTGTTTCTTGCTAAATAATCTGTTTCTTGCTGTGCATAAAACCTCAGTTTCTTCTTGTGCATAAAAACTCTGTTTCTTGTTGTGCATAAAACCTCTGTTTCTTTTTGTG
CTTAAAAACTCTGTTTCTTGCTGTGCATACAAACTCTGTTTCTTGTTCTCCATAGAACTTCTGTTTCTTGTTCTGCATAAAAATCTGTTTCTTGTTGTGGTATATGTTATCGTTTGGACA
GCTCGGAGGACCGGTAGTTGCGGTACCGACCGGGAGGAGAGACGGGACGGTCTCACTGGCAGAAAATGTCAGACCAAACATCATCGATACAGATTTCACAGTCGATAAGATGATCACTGT
CTTTTCCTCTAAAGGCTTATCTGTTCAAGATCTTGTCGTCCTCTCAG
GTATGTTTCTTGATGTTAATCTTCTCTTTCAAGCTCTGATTTTTCCAAACAAGATGATCAAGTTCGAGTCTAT
TACGGTCTCAGGAGCGCACACTATCGGAGCTGCGCATTGCAACACATTCAACAGCAGGTTTAAGAGAGATCCCAACGGCAATTTCGAGCTCATAGACGCGTCTCTCGACAACAACTACGC
GCAAACACTTATGAACAAGTGTTCATCGTCGATGGATCCTACGACCACGGTCGTAAACAACGATCCAGAGACATCGTCGACGTTTGACAATCAGTATTATAGGAATTTACAAGCGCACAA
GGGTCTGTTCCAGACGGATTCGGCTCTCATGGAAGATGAACGGACGAGGAAGATTGTTGAGATTCTAGCGAATGATGAGGAAATTTTTTTCGAGAGATGGAGTGAGTCATTTGTGAAGAT
GAGTGTGATGGGTGTGAGAGTTGGTGAAGAAGGTGAGATCAGACGATCTTGTTCTTTTGTTAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTGTACACAAAAATCTACATTCCTCTCACCTATTCTCGTTTTCCTTGCTCTACTTCTGCTTCTTTCTTCTTCAGTAGCTGACCTCTCTTTCAACTTCTACGCTGGTTCTTGT
CCCGGAGCAGAGTTCATCGTCAGGAACACCGTGAGATCGGCTTCAACCACTGATCCATCAATTCTTGGGAAGCTCCTCCGTCTCATCTTCCATGATTGTTTCGTGCAG
GGTTGCGATGCA
TCAGTGTTGATTCGAGGGAACGGTACAGAGAGAAGCGATCCAGGGAATGCGTCTCTGGGAGGATTCACTGTGATAGAAAGCGCCAAAAATGTCCTCGAAATCTTCTGTCCAGGCATAGTC
TCTTGCGCTGATATCCTTGTTCTTGCTGCTAGAGACGCTGTAGAAGCT
CTCGGAGGACCGGTAGTTGCGGTACCGACCGGGAGGAGAGACGGGACGGTCTCACTGGCAGAAAATGTCAGA
CCAAACATCATCGATACAGATTTCACAGTCGATAAGATGATCACTGTCTTTTCCTCTAAAGGCTTATCTGTTCAAGATCTTGTCGTCCTCTCAG
GAGCGCACACTATCGGAGCTGCGCAT
TGCAACACATTCAACAGCAGGTTTAAGAGAGATCCCAACGGCAATTTCGAGCTCATAGACGCGTCTCTCGACAACAACTACGCGCAAACACTTATGAACAAGTGTTCATCGTCGATGGAT
CCTACGACCACGGTCGTAAACAACGATCCAGAGACATCGTCGACGTTTGACAATCAGTATTATAGGAATTTACAAGCGCACAAGGGTCTGTTCCAGACGGATTCGGCTCTCATGGAAGAT
GAACGGACGAGGAAGATTGTTGAGATTCTAGCGAATGATGAGGAAATTTTTTTCGAGAGATGGAGTGAGTCATTTGTGAAGATGAGTGTGATGGGTGTGAGAGTTGGTGAAGAAGGTGAG
ATCAGACGATCTTGTTCTTTTGTTAATTAA

Retrieve as FASTA