Entry information : TsPrx32 (Thhalv10022759m)
Entry ID 9801
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-11-12 (Christophe Dunand)
Peroxidase information: TsPrx32 (Thhalv10022759m)
Name (synonym) TsPrx32 (Thhalv10022759m)
Class Class III peroxidase    [Orthogroup: Prx032]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type Leaves
Inducers Cold stress
Drought
Repressor N/D
Best BLASTp hits
Perox score E-value TsPrx32
start..stop
S start..stop
ThPrx32 729 0 5..357 1..353
BstrPrx67 676 0 5..357 1..352
AtPrx32 676 0 5..357 1..352
CrubPrx101 674 0 4..357 20..372
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 7796348..7796590 243 N° 2 7795128..7795319 192 N° 3 7794525..7794693 169 N° 4 7793971..7794440 470
complement(join(7793971..7794440,7794525..7794693,7795128..7795319,7796348..7796 590))


exon

Literature and cross-references TsPrx32 (Thhalv10022759m)
Literature Wong,C.E., Li,Y., Whitty,B.R., Diaz-Camino,C., Akhter,S.R., Brandle ,J.E., Golding,G.B., Weretilnyk,E.A., Moffatt,B.A. and Griffith,M. Expressed sequence tags from the Yukon ecotype of Thellungiella reveal that gene expression in response to cold, drought and salinity shows little overlap. Plant Mol. Biol. 58 (4), 561-574 (2005)
DNA ref. Phytozome 11:   scaffold_11 (7796590..7793971)
EST ref. GenBank:   DN772953.1 [5' end]   DN776068.1 [3' end]
Protein sequence: TsPrx32 (Thhalv10022759m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   358 (323)
PWM (Da):   %s   39346.6 (35476.8)  
PI (pH):   %s   7.36 (6.50) Peptide Signal:   %s   cut: 35 range:35-357
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTKKMHFSSFSSLSSWATIITMGCLMLHSSFSCAQLTPTFYDTSCPSVFNIVRDTIVNELRSDPRIAASILRLHFHDCFVNGCDASILLDNTTSFRTEKDAAPNANSARGFPVIDRMKTAVEAACPRVVSCADILTIAAQQSVNLAGGPSWRVPLGRRDSLQAFFDLSNANLPAPFFTLPQLKASFANVGLDRPSDLVALSGGHTFGKNQCQFIMDRLYNFSNTGLPDPTLNTTYLQTLRGLCPRNGNQSVLVDFDLRTPTVFDNKYYKNLKELKGLIQTDQELFSSPNATDTVPLVRSYADGTEKFFNAFIEAMNRMGNITPLTGSQGQIRQNCRVVNSNSLLHDVVEIVDFVSSM

Retrieve as FASTA  
Remarks Complete sequence from genomic. No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCAAAAAAATGCATTTCTCTTCTTTCTCTTCGTTGTCAAGTTGGGCAACCATAATAACAATGGGATGTCTTATGCTTCATTCATCTTTCTCCTGTGCTCAGCTAACTCCTACTTTT
TACGACACTTCATGCCCTAGCGTCTTCAACATCGTACGGGATACCATTGTTAACGAGCTACGGTCGGATCCTCGTATCGCTGCGAGCATCCTTCGACTTCACTTCCATGACTGCTTCGTT
AAT
GTAAGCTATTACTTTTCAAGTTTAGTAGTAGACTTTCGTTTAATTCATAATATATGTGTAGATTAGCTGTTATCGTAGAATTAAGTAGTTCCTTTTCTGTTATCATATATATTAAGA
AAACTACGTTTCACTAATGTTGATTGTTGTGGCAATCTTAGATTTTTGTTGTCAATATGTATTTTATCTACTTGAGTATGGAGACACTCAAGAAAATTCAAAAAGAATACGTCTTTGTCA
GTTGTAAATATTGGCAACGACAACATAACACGTGGTTTACAGTTTACCTGCATTAATAATTAATGAAATTTAATTAGAAGATTTAGTTTATAATAATTTTTGTGGTATTAGTTAAGATGA
TGCATTATCTACAATAATAGTCAGTGGCCTAACGGATCTGATCCAGAAAAATTATCATTATAAAATATCACATACTTAGATTTGGTTCTTACTGTCCAATATCCTAGCTATTGTCGTCAA
AAATGAGTTATTATTTAATCTACTGTAGACAGATGATCCCAAAACATATACACCAATTCAGCAAACATCAATTGTTTGTATTATAGACTATTAGGAAGAGCGTGGACCCGTACCAAACAC
GTTACGAATTTATTATATCAATCATTTATGGTTAGGAAAGAAGAAAAAATATTATAAATCATTCAAACATTTCACGCTTACCGTAAACCTAATTTATTCATATTTTTAAAAAGAAATTTA
ATCTTTCAATCAGGTGTTGTTGTTAGAACAATTGTTTTAACGTGTGATGTTTCTTGAACCATAGTAAACCAGAAATTACTCTACAAAAAAGAAGTAGAAATACAGTAGAAATATTATCAT
AGGCTAATAATCAAAATTGTGAATTTGGTGTTAGGCGTTAAAATAAATTATATACAGTATTACTTTGTGTCTACTATGTTTGTTTTAGTGAATGATAAACATAATCTCACGATGTTTACG
GGTGTCAAAAATTTGATCATGGTTGAAAATCATTGACTAATCTTCGAACAATTCGTTTTCGTTTGCAAAAGGGTTGTGATGCATCGATCTTGTTAGACAACACAACATCATTTCGAACAG
AAAAAGACGCAGCGCCAAATGCCAATTCGGCTCGGGGATTTCCAGTGATTGATAGAATGAAAACAGCAGTTGAAGCAGCATGCCCAAGGGTTGTTTCATGTGCAGATATTCTTACCATCG
CAGCTCAACAATCTGTCAATTTG
GTATACTCTATTTACACAACCCTCGCTTTTTCAATTTTATGCAAAACACTGTTTTAAATTCCTACTGCCCTACATGAAGTCGTCAGTAGATATATTA
CACATCACAACACATGATTGAAGAAAAAACTTTAATAATCAAGTTGTTTGAGAACATGACAATTTATATTTAATGCTATCCTCCTATTTACTATTTAAACAAAATTCAAGTTTTAATATT
ATTGTTAGGTGTATCAATTAGAAGGAAAAAAAATATTTAGCGTATTAATAAAGACAAAATAATTTTTTGAATGTTTTTTTATACATCTGGAAAACTGTAAAATAACAGGACTCTTTGTGG
AACAAAGAAAGTATAAGTTTTTGTTTTTGTGTATAAAACATCAATACTTTTACATTGTCAACATTATTTTTCTAAACAAATCATATGGATATTTTAGGCAGGAGGTCCTTCTTGGAGGGT
TCCTTTGGGGAGACGAGATAGCTTACAAGCATTTTTTGATCTCTCTAATGCAAATCTTCCCGCTCCATTCTTCACACTTCCACAACTTAAAGCCAGTTTTGCAAATGTCGGTCTCGATCG
TCCTTCTGATCTCGTTGCTCTCTCCG
GTAATCATGTTTCCTTAGTAACAATAATCAAAATACACATTTGATGTATTTATACTAACGAATGTGGTGACTGTTATTCTCTAGGTGGTCACAC
GTTTGGTAAAAACCAATGTCAGTTTATTATGGACAGGCTATACAACTTCAGCAACACTGGTTTACCAGATCCTACCCTCAACACTACTTATCTCCAGACTCTTCGCGGACTGTGCCCTCG
TAATGGTAACCAGAGCGTTTTAGTGGATTTCGACCTACGAACACCGACGGTTTTCGACAACAAATACTATAAGAATCTGAAAGAGCTCAAAGGACTTATCCAAACTGATCAAGAGTTGTT
CTCGAGCCCCAATGCGACTGACACAGTCCCCTTGGTTAGATCATATGCTGATGGCACGGAAAAGTTCTTCAATGCGTTCATCGAAGCGATGAATAGGATGGGAAACATTACGCCTTTGAC
CGGCTCTCAAGGACAGATCAGGCAGAACTGTAGGGTGGTCAACTCCAACTCGTTGCTCCATGATGTGGTTGAAATAGTTGACTTTGTCAGCTCTATGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCAAAAAAATGCATTTCTCTTCTTTCTCTTCGTTGTCAAGTTGGGCAACCATAATAACAATGGGATGTCTTATGCTTCATTCATCTTTCTCCTGTGCTCAGCTAACTCCTACTTTT
TACGACACTTCATGCCCTAGCGTCTTCAACATCGTACGGGATACCATTGTTAACGAGCTACGGTCGGATCCTCGTATCGCTGCGAGCATCCTTCGACTTCACTTCCATGACTGCTTCGTT
AAT
GGTTGTGATGCATCGATCTTGTTAGACAACACAACATCATTTCGAACAGAAAAAGACGCAGCGCCAAATGCCAATTCGGCTCGGGGATTTCCAGTGATTGATAGAATGAAAACAGCA
GTTGAAGCAGCATGCCCAAGGGTTGTTTCATGTGCAGATATTCTTACCATCGCAGCTCAACAATCTGTCAATTTG
GCAGGAGGTCCTTCTTGGAGGGTTCCTTTGGGGAGACGAGATAGC
TTACAAGCATTTTTTGATCTCTCTAATGCAAATCTTCCCGCTCCATTCTTCACACTTCCACAACTTAAAGCCAGTTTTGCAAATGTCGGTCTCGATCGTCCTTCTGATCTCGTTGCTCTC
TCCG
GTGGTCACACGTTTGGTAAAAACCAATGTCAGTTTATTATGGACAGGCTATACAACTTCAGCAACACTGGTTTACCAGATCCTACCCTCAACACTACTTATCTCCAGACTCTTCGC
GGACTGTGCCCTCGTAATGGTAACCAGAGCGTTTTAGTGGATTTCGACCTACGAACACCGACGGTTTTCGACAACAAATACTATAAGAATCTGAAAGAGCTCAAAGGACTTATCCAAACT
GATCAAGAGTTGTTCTCGAGCCCCAATGCGACTGACACAGTCCCCTTGGTTAGATCATATGCTGATGGCACGGAAAAGTTCTTCAATGCGTTCATCGAAGCGATGAATAGGATGGGAAAC
ATTACGCCTTTGACCGGCTCTCAAGGACAGATCAGGCAGAACTGTAGGGTGGTCAACTCCAACTCGTTGCTCCATGATGTGGTTGAAATAGTTGACTTTGTCAGCTCTATGTAA

Retrieve as FASTA