Entry information : TsAPx-R (Thhalv10025686m)
Entry ID 9804
Creation 2011-11-18 (Qiang Li)
Last sequence changes 2011-11-21 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2015-12-30 (Christophe Dunand)
Peroxidase information: TsAPx-R (Thhalv10025686m)
Name (synonym) TsAPx-R (Thhalv10025686m)
Class Ascorbate peroxidase related    [Orthogroup: APx-R001]
Taxonomy Eukaryota Viridiplantae Streptophyta Brassicaceae Eutrema
Organism Thellungiella salsuginea (Eutrema salsugineum)    [TaxId: 72664 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value TsAPx-R
start..stop
S start..stop
AlyAPx-R 570 0 3..330 2..329
AtAPx-R 569 0 3..330 2..329
BstrAPx-R01 555 0 3..330 2..331
AhalAPx-R01 552 0 3..330 2..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3288921..3289113 193 N° 2 3288749..3288845 97 N° 3 3288536..3288651 116 N° 4 3288327..3288397 71
N° 5 3288160..3288202 43 N° 6 3287985..3288081 97 N° 7 3287810..3287893 84 N° 8 3287602..3287723 122
N° 9 3287410..3287476 67 N° 10 3287221..3287323 103  
complement(join(3287221..3287323,3287410..3287476,3287602..3287723,3287810..3287 893,3287985..3288081,3288160..3288202,3288327..3288397,3288536..3288651,3288749. .3288845,3288921..3289113))


exon

Literature and cross-references TsAPx-R (Thhalv10025686m)
Literature Taji,T., Sakurai,T., Mochida,K., Ishiwata,A., Kurotani,A., Totoki,Y., Toyoda,A., Sakaki,Y., Seki,M., Ono,H., Sakata,Y., Tanaka,S. and Shinozaki,K. BMC Plant Biol. 8, 115 (2008).
DNA ref. Phytozome 11:   scaffold_1 (3289113..3287221)
EST ref. GenBank:   BAJ34274
Protein sequence: TsAPx-R (Thhalv10025686m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331
PWM (Da):   %s   35789.33  
PI (pH):   %s   8.96
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTTTTTASLFETSLSRCYSSSSSSSSFKFESPAKTKTRLFSPATGNHVIRSVTACRIRCASDDPGSVFLSSRRKVVVLLSTMQLLSQSLPPNGNAAEIYQLMQNEIKKVVTKGKAAGVLRLVFHDAGTFELDDNTGGINGSIAYELERPENTGLKKSLKVLAKAKIKVDEIQPVSWADMISVAGSVAVSICGGPTIPVVLGRLDSTQPDPEDKLPPESLSASGLKECFKRKGFSTQELVALSGAHTLGSKGFGDPTVFDNAYYKILLAKPWTSASKMTSMVGLPSDHALVEDDECLRWVKRYAEDQDKFFQDFTNAYTKLVNSGAKWKML*

Retrieve as FASTA  
Remarks Complete sequence from genomic and 1 EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGACGACTGCGTCTCTGTTTGAAACTTCTCTTTCTCGGTGCTACTCGTCTTCTTCTTCTTCTTCTTCTTTCAAATTCGAATCTCCCGCGAAAACGAAAACGCGACTGTTC
TCGCCAGCGACTGGGAATCATGTTATCCGATCGGTGACAGCATGTCGTATCCGTTGCGCCTCCGATGATCCTG
GTAAGACCGGATTCTAGTATAGTTTGCACACTCTGTTCTACATGGCT
TAATGTTGTGTTTCTGGGAAATTCCTAGGATCTGTTTTTCTTTCCAGTAGAAGAAAAGTAGTTGTTCTGTTGTCCACGATGCAGCTTCTGTCTCAGTCACTTCCCCCAAATGGAAATGCA
GCTGA
GTGAGTTTGAGCAAATCCTTGTTTTTATAATTGACCACCAAAAAGATTGTTCCTTTTTTTTTAATGTAATTTCTGAAATCGAGTGTTGGGATTTCAGAATTTATCAACTGATGCA
AAACGAAATAAAGAAAGTGGTGACAAAGGGAAAGGCTGCTGGTGTGCTTCGTTTAGTGTTTCATGATGCTGGAACCTTTGAGCTCGACGATAATACAG
GTAATTTCAAAGCTTGGTCGGT
TTAGGTTCAGTTTGCTCCTTTTGCTGCTTCTTTCTCAGTAACAAGATACTGCAATCCACTTTAGTTGAGATCAGTTATGTCTTATTTGTTCTTTCTTGGTAATGAAATGATTGCAGGTGG
CATCAACGGGTCTATTGCTTACGAACTCGAGAGACCTGAAAACACAGGTTTGAAGAAATCCCTAAAG
GCACTAAATCCCTCTCCTTTTTGTTTGTTGTTGTTGTTGTTGTTATTTGCACT
TGTATCTCAGAATTTTTCAAATATTTTACTTTCAAATAGCTAATTTTCATGGTAGATGGAATCTATGTTAGGTTCTAGCGAAAGCAAAGATAAAGGTTGATGAGATACAACCAGGTAATT
ACTGTTTCAACTTTACACACCAGAGAAATGTGTCCTGTTAGTGCAAAATGTTCTCAATCTGTGTGTTCTTAGTGTCTTGGGCGGATATGATATCTGTCGCTGGGTCTGTAGCGGTTTCAA
TATGTGGCGGCCCAACAATTCCAGTAGTTTTGGGAAGACTTGATTCAAC
GTAAGCAATGGTACTCCTTCCCCTCTCTCTCTCTCTCTCAAAGACACTGTTTCTATATTTTTAACAGGATG
ATTGTTTCAATGTTTCACAGGCAACCTGATCCAGAAGACAAGCTACCTCCAGAATCCCTGAGTGCCTCGGGTTTGAAAGAATGCTTCAAAAGAAAAGGATTTTCGTGAGTTTTTCTTACA
CAAAACATAGCTGAGACTAGAAGACTCATGTTAACATTTTGTAACTTGGGGGTTTGTGTTGCCATTGCAGGACCCAAGAACTTGTTGCCTTATCTGGGGCACATACGCTTGGGAGTAAAG
GCTTTGGAGATCCAACTGTTTTTGACAATGCATATTACAAAATCCTTCTCGCAAAGCCTTGGACATCGGCAT
GTAAGTCTCGTGACAAAGTTCTTGCTACTGTCTCTACAGTTTCATCAT
CTGCCATGTTCCGAGCTGTTATACTGAGATTATATCCTTACATAGTTTATCTTATTATGACTCCATTTCGGATGCAGCCAAAATGACGAGCATGGTCGGGCTTCCTTCGGATCACGCCTT
AGTGGAGGATGATGAGTGCTTAAG
GTTTCTCATCTTACATTTACGATTTTCATTTTTGCTATCGATAGTAACATTCAAAAATGATATAAGATTCGTGGTTTGGTGCATAGGTGGGTGAAA
CGATATGCGGAAGATCAAGACAAGTTCTTCCAAGACTTCACCAATGCTTATACCAAACTAGTCAATTCTGGGGCCAAATGGAAAATGTTATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACGACGACGACGACTGCGTCTCTGTTTGAAACTTCTCTTTCTCGGTGCTACTCGTCTTCTTCTTCTTCTTCTTCTTTCAAATTCGAATCTCCCGCGAAAACGAAAACGCGACTGTTC
TCGCCAGCGACTGGGAATCATGTTATCCGATCGGTGACAGCATGTCGTATCCGTTGCGCCTCCGATGATCCTG
GATCTGTTTTTCTTTCCAGTAGAAGAAAAGTAGTTGTTCTGTTGTCC
ACGATGCAGCTTCTGTCTCAGTCACTTCCCCCAAATGGAAATGCAGCTGA
AATTTATCAACTGATGCAAAACGAAATAAAGAAAGTGGTGACAAAGGGAAAGGCTGCTGGTGTGCTTCGT
TTAGTGTTTCATGATGCTGGAACCTTTGAGCTCGACGATAATACAG
GTGGCATCAACGGGTCTATTGCTTACGAACTCGAGAGACCTGAAAACACAGGTTTGAAGAAATCCCTAAAGGTT
CTAGCGAAAGCAAAGATAAAGGTTGATGAGATACAACCAG
TGTCTTGGGCGGATATGATATCTGTCGCTGGGTCTGTAGCGGTTTCAATATGTGGCGGCCCAACAATTCCAGTAGTTTTG
GGAAGACTTGATTCAAC
GCAACCTGATCCAGAAGACAAGCTACCTCCAGAATCCCTGAGTGCCTCGGGTTTGAAAGAATGCTTCAAAAGAAAAGGATTTTCGACCCAAGAACTTGTTGCC
TTATCTGGGGCACATACGCTTGGGAGTAAAGGCTTTGGAGATCCAACTGTTTTTGACAATGCATATTACAAAATCCTTCTCGCAAAGCCTTGGACATCGGCAT
CCAAAATGACGAGCATG
GTCGGGCTTCCTTCGGATCACGCCTTAGTGGAGGATGATGAGTGCTTAAG
GTGGGTGAAACGATATGCGGAAGATCAAGACAAGTTCTTCCAAGACTTCACCAATGCTTATACCAAACTA
GTCAATTCTGGGGCCAAATGGAAAATGTTATGA

Retrieve as FASTA